fancg

Ensembl ID:
ENSDARG00000024967
ZFIN ID:
ZDB-GENE-050417-103
Description:
fanconi anemia complementation group G protein [Source:RefSeq peptide;Acc:NP_991202]
Human Orthologue:
FANCG
Human Description:
Fanconi anemia, complementation group G [Source:HGNC Symbol;Acc:3588]
Mouse Orthologue:
Fancg
Mouse Description:
Fanconi anemia, complementation group G Gene [Source:MGI Symbol;Acc:MGI:1926471]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20504 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15941 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039369 Essential Splice Site 93 617 3 14

The following transcripts of ENSDARG00000024967 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 43115699)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTAACCCAAGCGAGATGGAGGAGAGTCTGACCCGCAGTTTATTCAGAG[G/A]TAAGTACAGCAGCGTCGTTTATTGCTCATTTACATGCCGTATTGTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15941
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039369 Nonsense 273 617 7 14

The following transcripts of ENSDARG00000024967 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 43119093)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTATAGGAAGGCAKTGGAGGTAGATTTTTCTTGTCTTGGYGCACTTTA[T/A]CAAAGTGCTCTGGTGTTCAGACAGCTTGGCAATCCAAAGGCWGAAATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n1exa1kh