LOC571279

Ensembl ID:
ENSDARG00000024966
Human Orthologue:
MARK4
Human Description:
MAP/microtubule affinity-regulating kinase 4 [Source:HGNC Symbol;Acc:13538]
Mouse Orthologue:
Mark4
Mouse Description:
MAP/microtubule affinity-regulating kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1920955]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22640 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009796 Essential Splice Site 630 755 15 17
Genomic Location:
Chromosome 15 (position 22981200)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGCCACCACAAACCTGTTCACTAAGCTGACCTCTAAACTTACCCGCAG[G/A]TAAGAGGAAAGCGACAGTTTCATTTTGTAAGCCTGAGAATAAACTTTTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w79akfdw