inadl

Ensembl ID:
ENSDARG00000024964
ZFIN ID:
ZDB-GENE-030616-129
Description:
InaD-like [Source:RefSeq peptide;Acc:NP_001120657]
Human Orthologue:
INADL
Human Description:
InaD-like (Drosophila) [Source:HGNC Symbol;Acc:28881]
Mouse Orthologue:
Inadl
Mouse Description:
InaD-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1277960]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24137 Nonsense Available for shipment Available now
sa6702 Nonsense Mutation detected in F1 DNA During 2017
sa37482 Nonsense Mutation detected in F1 DNA During 2017
sa648 Nonsense F2 line generated During 2017
sa24136 Nonsense Available for shipment Available now
sa32397 Essential Splice Site, Missense Available for shipment Available now
sa5970 Nonsense Mutation detected in F1 DNA During 2017
sa43805 Nonsense Mutation detected in F1 DNA During 2017
sa24135 Essential Splice Site Available for shipment Available now
sa43804 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036467 Nonsense 111 1180 3 41
ENSDART00000132829 Nonsense 115 1831 4 45
ENSDART00000145208   None 98 None 5
Genomic Location (Zv9):
Chromosome 22 (position 16971854)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16723612
KASP Assay ID:
2261-6669.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGATCAGTTCTGTCCAATGGCACGGCTTTAACTAACGCCTCTTCTGAG[C/T]AGCTTCAGAGGTGGATACAGGCAGCTGCAAAGGTGAGGAGTTATTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036467 Nonsense 248 1180 9 41
ENSDART00000132829 Nonsense 234 1831 7 45
ENSDART00000145208   None 98 None 5
Genomic Location (Zv9):
Chromosome 22 (position 16959657)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16711415
KASP Assay ID:
554-4601.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAGTCAAGGGATTGAAARCGGTCCCCSGTGTGTGTCTTTTGCAGGAT[C/T]AGTGGGGACACGTGGAGGAGATCGAGCTGGTGAATGATGGATCCGGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036467 Nonsense 516 1180 17 41
ENSDART00000132829   None 1831 None 45
ENSDART00000145208   None 98 None 5
Genomic Location (Zv9):
Chromosome 22 (position 16945552)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16697310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGTGGTTTTGCTAAATTTCACCCGTCAATTTTATAGATAACAACCCT[G/T]GAAGTGCCATTAAAATTTATTTTGTGTCACGTAAAAGTTGACAAGCCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa648
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036467 Nonsense 543 1180 18 41
ENSDART00000132829 Nonsense 526 1831 13 45
ENSDART00000145208   None 98 None 5
Genomic Location (Zv9):
Chromosome 22 (position 16942443)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16694201
KASP Assay ID:
554-0556.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAAGAGCCGGCCTCGCTGACGGAGATGGAGCTTCGCGCTAAATGGGAG[C/T]AGGCTCTTGGTCCACATTACGATGTTATGGTAAGCAAAAACGAAGAGGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa24136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036467 Nonsense 648 1180 21 41
ENSDART00000132829 Nonsense 631 1831 16 45
ENSDART00000145208   None 98 None 5
Genomic Location (Zv9):
Chromosome 22 (position 16940425)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16692183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCTTTCCTTAGAGAAGTTCCTACTCCATTTACTTTGGTTTGCTGCAGA[C/T]GACTTGCTAAAGAGGACAACGAATATCACCCTGAATCTGAAGACTGGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036467 Essential Splice Site 650 1180 22 41
ENSDART00000132829 Missense 684 1831 18 45
ENSDART00000145208   None 98 None 5
Genomic Location (Zv9):
Chromosome 22 (position 16939032)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16690790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTCACCATGATTTGTACATTTCTTTTCAGGCCCGTCAGGCTTCGGCA[G/A]TAGAGCGGGAGGTTGACGATGAAGGAGAGCCCCTAGAGCCAATCAGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036467 Nonsense 698 1180 22 41
ENSDART00000132829 Nonsense 732 1831 18 45
ENSDART00000145208   None 98 None 5
Genomic Location (Zv9):
Chromosome 22 (position 16938888)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16690646
KASP Assay ID:
554-3668.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAGAGGANNNNNNGGAGGATGAAGGAGAACTAGCWCTATGGTCTCCAAATGTG[C/T]AAGTGTTAGAACTAGAGAAAKCAGAGCGAGGTCTTGGCTTCAGTATACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036467 Nonsense 934 1180 32 41
ENSDART00000132829 Nonsense 930 1831 21 45
ENSDART00000145208   None 98 None 5
Genomic Location (Zv9):
Chromosome 22 (position 16923962)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16675720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGGACCAGCAGAGCTCTAAGGTCAATGACACCAGTCTGCCTTCATA[T/A]CTCAGTGAGAAGAGTCGCTCCTGGGAAGAACCAGCAACATCCAGCCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24135
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036467 Essential Splice Site 977 1180 33 41
ENSDART00000132829 Essential Splice Site 979 1831 22 45
ENSDART00000145208   None 98 None 5
Genomic Location (Zv9):
Chromosome 22 (position 16923730)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16675488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCATGAATTTGGAGAAGATTCAACTGCAGCCATTGAAAATTCCTCTCG[G/A]TAAGTGTCTGTTAAAGCTTTTTAACACTTTCCAGGCTGTTGATAAGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036467   None 1180 None 41
ENSDART00000132829 Essential Splice Site 1209 1831 29 45
ENSDART00000145208   None 98 None 5
Genomic Location (Zv9):
Chromosome 22 (position 16906054)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16657812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCAGGAGGAGGAGCATGAGCAGGAGGAGGAGGATGAGCAGGATACAG[G/A]TGAGAGACTGCTGGTCATTACACACTTGCTGTGTTTGGAGTCAAACTGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link