LOC566628

Ensembl ID:
ENSDARG00000024936
Human Orthologue:
PSKH2
Human Description:
protein serine kinase H2 [Source:HGNC Symbol;Acc:18997]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35369 Nonsense Mutation detected in F1 DNA During 2016
sa14690 Essential Splice Site Available for shipment Available now
sa42093 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037703 Nonsense 19 389 1 4
Genomic Location (Zv9):
Chromosome 12 (position 43490978)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 40855362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCTCTGGAAAAGTCTTACCCGAGTCTTCCTCTTCCAAACGAGGATA[T/A]TTTTGCCTCTTCAACTCGATTGTGATCTTCAACAAACAAGAGTCTGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14690
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037703 Essential Splice Site 234 389 2 4
Genomic Location (Zv9):
Chromosome 12 (position 43485771)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 40860569
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACARGACTCGCGGCTGATCATCACAGATTTYGGGCTGGCCTGTTGGGA[T/G]AAGTCCATACAGAGGGATGATCTGGAGTTGACTGTGGGATTWGAGGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037703 Nonsense 251 389 3 4
Genomic Location (Zv9):
Chromosome 12 (position 43485681)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 40860659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGAGGAGAAAGGTTGGGCGTTGAGGACACTCTGCGGGACGCCTGAATA[C/A]CTGGCACCGGAGATGTTGGCGCGGAGAGGCTGTGGCAGAGCGGTGGACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link