NP_001020335.1

Ensembl ID:
ENSDARG00000024928
Description:
inter-alpha (globulin) inhibitor H4 isoform 1 [Source:RefSeq peptide;Acc:NP_001020335]
Human Orthologue:
ITIH4
Human Description:
inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein) [Source:HGNC Symbol;A
Mouse Orthologue:
Itih4
Mouse Description:
inter alpha-trypsin inhibitor, heavy chain 4 Gene [Source:MGI Symbol;Acc:MGI:109536]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30433 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035094 Nonsense 281 422 7 9
Genomic Location (Zv9):
Chromosome Zv9_NA904 (position 5883)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36943313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCCACAAACATAAATGATGCCGTTCTAGCAGGAGTGGACATGATCAAT[C/T]GAAATCCACGAAAAGGAACAGCCTCCATCCTGATCCTGTTGACTGATGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link