dock4b

Ensembl ID:
ENSDARG00000024874
ZFIN ID:
ZDB-GENE-060130-74
Description:
dedicator of cytokinesis 4b [Source:RefSeq peptide;Acc:NP_001159700]
Human Orthologue:
DOCK4
Human Description:
dedicator of cytokinesis 4 [Source:HGNC Symbol;Acc:19192]
Mouse Orthologue:
Dock4
Mouse Description:
dedicator of cytokinesis 4 Gene [Source:MGI Symbol;Acc:MGI:1918006]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17211 Essential Splice Site Available for shipment Available now
sa33381 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20201 Nonsense Available for shipment Available now
sa20202 Nonsense Available for shipment Available now
sa40222 Nonsense Mutation detected in F1 DNA During 2017
sa16345 Nonsense Available for shipment Available now
sa12293 Essential Splice Site Available for shipment Available now
sa15932 Essential Splice Site Available for shipment Available now
sa16113 Nonsense Available for shipment Available now
sa14015 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036646 Essential Splice Site 39 1977 None 52
ENSDART00000136355 Essential Splice Site 15 1132 None 32

The following transcripts of ENSDARG00000024874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 6266804)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6869348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTCAAYCCTGAGCTATTACTTATCRATTGCTGTTTTTTTGTGTGTTTC[A/C]GTGCTGGCCGGTTTCCGAGGAACGGTTCAGCATGGCTTGCCTCTGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036646 Essential Splice Site 66 1977 2 52
ENSDART00000136355 Essential Splice Site 42 1132 2 32

The following transcripts of ENSDARG00000024874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 6266890)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6869434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGCCTCTGGAGATTGGTGATACGGTGCAGATCCTGGAGAAATGTGAAG[G/A]TATACACGAGCACTGATTCAGTTCATCATTATTTCTATAGCACTTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036646 Nonsense 542 1977 16 52
ENSDART00000136355 Nonsense 518 1132 16 32

The following transcripts of ENSDARG00000024874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 6310026)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6912570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAAGCTGTTTGGATTCTCATTCGTCCCTCTGATGCAGGAAGACGGA[C/T]GAACTTTACCTGACGGGACACACGAACTCATTGTACATAAGGTGAAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036646 Nonsense 673 1977 20 52
ENSDART00000136355 Nonsense 646 1132 20 32

The following transcripts of ENSDARG00000024874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 6316288)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6918832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTGTCTTTATGTATTCATTGTTGTCATGCAGGTGCACATTATAAACT[T/A]GCTTCAGGATAGCAAGTTTCAGCATTTTAAACCAGTCATGGACACCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036646 Nonsense 689 1977 20 52
ENSDART00000136355 Nonsense 662 1132 20 32

The following transcripts of ENSDARG00000024874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 6316337)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6918881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTTCAGGATAGCAAGTTTCAGCATTTTAAACCAGTCATGGACACCTA[C/A]ATCGAAAGCCACTTTGCTGGAGCCCTGTCATACAGGTATGCTAAAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036646 Nonsense 736 1977 22 52
ENSDART00000136355 Nonsense 709 1132 22 32

The following transcripts of ENSDARG00000024874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 6319665)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6922209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGCTGNNNTTTTTTTCTCTCTCTCAAGGCAACAGAGTATATTTTTAAGTA[T/A]ATCGTCCAGTCCCGGAGGCTGTTTGCGCTGGCCACAGGCGGACAGAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036646 Essential Splice Site 1061 1977 29 52
ENSDART00000136355 Essential Splice Site 1034 1132 29 32

The following transcripts of ENSDARG00000024874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 6333690)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6936234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAGCTCGAGACTTTCTCTGCCTCGAAGAAAAARAAAATACTAGAGAA[G/A]TGAGTGCCGGAAACCTGTCTAAATGATCTTATTAATAAAAATGTTTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036646 Essential Splice Site 1159 1977 None 52
ENSDART00000136355   1132 1132 32 32

The following transcripts of ENSDARG00000024874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 6335736)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6938280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGAGGGCAAAGGAGACGAGACCTACAGRGAGCTTTTCAAYAGCATG[T/A]AAGTCGAAACATTGAAAAATTATAACTATACATGCTTGATTAGATGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16113
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036646 Nonsense 1362 1977 39 52
ENSDART00000136355   None 1132 None 32

The following transcripts of ENSDARG00000024874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 6344950)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6947494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTTATTTGTGTGTGTGYKTGTGATGTGCAGAATAAGGAGTTTGTGTG[T/A]CGTGGTCATGACTACGAGCGTCTGGAGGCGTTCCAGCAGCGCATGCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036646 Nonsense 1855 1977 52 52
ENSDART00000136355   None 1132 None 32

The following transcripts of ENSDARG00000024874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 6379004)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6981207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCGTGCCGCCATTCACACCGTCTYCCAYAGAGTGCCAGTCTACAGGGT[T/A]GGTGTCTAATTCGCCGGTGCTTTCCGGAAGCTACAGCAGCGGTATCTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link