dscam

Ensembl ID:
ENSDARG00000024865
ZFIN ID:
ZDB-GENE-050310-7
Description:
Down syndrome cell adhesion molecule [Source:RefSeq peptide;Acc:NP_001025395]
Human Orthologue:
DSCAM
Human Description:
Down syndrome cell adhesion molecule [Source:HGNC Symbol;Acc:3039]
Mouse Orthologue:
Dscam
Mouse Description:
Down syndrome cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1196281]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41717 Nonsense Mutation detected in F1 DNA During 2017
sa31795 Nonsense Available for shipment Available now
sa21791 Nonsense Available for shipment Available now
sa21792 Essential Splice Site Available for shipment Available now
sa41718 Nonsense Mutation detected in F1 DNA During 2017
sa41719 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21793 Essential Splice Site Available for shipment Available now
sa11753 Essential Splice Site Available for shipment Available now
sa7221 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18994 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11007 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098963 Nonsense 92 2023 2 33
ENSDART00000125045 Nonsense 93 2024 2 33
ENSDART00000136928 Nonsense 79 2010 1 32
Genomic Location (Zv9):
Chromosome 10 (position 40154364)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38870215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCAACGGCACTCTCCAGATCTTCCACTTTCCTCCGTCCAGCTTTAGC[A/T]AAGTGATCCACGACAACACTTACTATTGCACAGCGGAAAATCCTTCAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098963 Nonsense 125 2023 3 33
ENSDART00000125045 Nonsense 126 2024 3 33
ENSDART00000136928 Nonsense 112 2010 2 32
Genomic Location (Zv9):
Chromosome 10 (position 40158789)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38874640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGTGTCGATGACGTAAACTCTTTCTCTGTAGTCTTACGGGAGCCCTA[T/A]ACGGTCCGTGTGGCGGACCAGACCGCGATGAGAGGCAGCGTAGCGGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098963 Nonsense 207 2023 4 33
ENSDART00000125045 Nonsense 208 2024 4 33
ENSDART00000136928 Nonsense 194 2010 3 32
Genomic Location (Zv9):
Chromosome 10 (position 40222397)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38938248
KASP Assay ID:
2260-3581.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTTCAACTACCGCTGCATGACGAGACATCGCTACACGTCCGAGACA[C/T]GACAGAGCAACAGCGCACGGCTCTTTGTGCCAGGTAAAAGTGCTTGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098963 Essential Splice Site 502 2023 8 33
ENSDART00000125045 Essential Splice Site 503 2024 8 33
ENSDART00000136928 Essential Splice Site 489 2010 7 32
Genomic Location (Zv9):
Chromosome 10 (position 40231425)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38947276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTCCATCGCAATGTCAATGTTCTTTTAAAGAGAAGTGTTTCTGTTTA[A/G]GGTTCCGCCGACATTCGACCAATGAAAAACCTCACTGCCATAGCTGGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098963 Nonsense 549 2023 8 33
ENSDART00000125045 Nonsense 550 2024 8 33
ENSDART00000136928 Nonsense 536 2010 7 32
Genomic Location (Zv9):
Chromosome 10 (position 40231567)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38947418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCATCAAATGGTTCAAAAACTCCAACCTCCTCCCTTTCAATGACCGT[C/T]AGCGAGCATTTGAGAACAACGGCACGCTGAAGCTGCTGAACGTGCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098963 Essential Splice Site 726 2023 10 33
ENSDART00000125045 Essential Splice Site 727 2024 10 33
ENSDART00000136928 Essential Splice Site 713 2010 9 32
ENSDART00000098963 Essential Splice Site 726 2023 10 33
ENSDART00000125045 Essential Splice Site 727 2024 10 33
ENSDART00000136928 Essential Splice Site 713 2010 9 32
Genomic Location (Zv9):
Chromosome 10 (position 40234810)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38950661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCGGATGGAGAGCCCAGGCCCACTATTGAGTGGAAATACTCCAAAG[G/T]TACCGAGATTCACCCACATCTACCTATTTTTTTATTTGGTCTTGTTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098963 Essential Splice Site 726 2023 10 33
ENSDART00000125045 Essential Splice Site 727 2024 10 33
ENSDART00000136928 Essential Splice Site 713 2010 9 32
ENSDART00000098963 Essential Splice Site 726 2023 10 33
ENSDART00000125045 Essential Splice Site 727 2024 10 33
ENSDART00000136928 Essential Splice Site 713 2010 9 32
Genomic Location (Zv9):
Chromosome 10 (position 40234810)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38950661
KASP Assay ID:
2260-3584.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCGGATGGAGAGCCCAGGCCCACTATTGAGTGGAAATACTCCAAAG[G/T]TACCGAGATTCACCCACATCTACCTATTTTTTTATTTGGTCTTGTTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098963 Essential Splice Site 1094 2023 18 33
ENSDART00000125045 Essential Splice Site 1095 2024 18 33
ENSDART00000136928 Essential Splice Site 1081 2010 17 32
Genomic Location (Zv9):
Chromosome 10 (position 40268613)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38984464
KASP Assay ID:
2260-3585.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGCAATCATGGCTAATGTGTCAGATTTGTGTTGGTTTTGTGTTTCTCA[G/A]TTCCCAGCAGAGCTCCAGAGAAGGTGGTGGCYACCGCTGCATCCCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098963 Essential Splice Site 1417 2023 24 33
ENSDART00000125045 Essential Splice Site 1418 2024 24 33
ENSDART00000136928 Essential Splice Site 1404 2010 23 32
Genomic Location (Zv9):
Chromosome 10 (position 40288094)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39003945
KASP Assay ID:
554-5055.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAACCGTGACCTGGACGCCCGGAGACAACGGCGGGAGYTCCATTAGAGG[T/G]GAGCGTTTACACCTTCAGATGGGRGAAAAAAGAAAGCAAACTYATTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098963 Essential Splice Site 1577 2023 27 33
ENSDART00000125045 Essential Splice Site 1578 2024 27 33
ENSDART00000136928 Essential Splice Site 1564 2010 26 32
ENSDART00000098963 Essential Splice Site 1577 2023 27 33
ENSDART00000125045 Essential Splice Site 1578 2024 27 33
ENSDART00000136928 Essential Splice Site 1564 2010 26 32
Genomic Location (Zv9):
Chromosome 10 (position 40291641)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39007492
KASP Assay ID:
2260-3586.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGTTTGTGCATGAAATGCTAAACATGGATTTATTTTGTTTGTCAAA[G/A]GCACCATTCCTCCATTGGTGAAGACTCTGGTGAAGGACCCCGTGAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098963 Essential Splice Site 1577 2023 27 33
ENSDART00000125045 Essential Splice Site 1578 2024 27 33
ENSDART00000136928 Essential Splice Site 1564 2010 26 32
ENSDART00000098963 Essential Splice Site 1577 2023 27 33
ENSDART00000125045 Essential Splice Site 1578 2024 27 33
ENSDART00000136928 Essential Splice Site 1564 2010 26 32
Genomic Location (Zv9):
Chromosome 10 (position 40291641)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39007492
KASP Assay ID:
2260-3586.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTKTTTGTGCATGAAATGCTAAACATKGATTTATTWTGTTTGTCAAA[G/A]GCACCATTCCTCCATTGGTGAAGACTCTGGTGAAGGACCCCGTGAAGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Non-small cell lung cancer: Genome-wide association study on overall survival of advanced non-small cell lung cancer patients treated with carboplatin and paclitaxel. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link