cops8

Ensembl ID:
ENSDARG00000024846
ZFIN ID:
ZDB-GENE-040426-982
Description:
COP9 signalosome complex subunit 8 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUZ0]
Human Orthologue:
COPS8
Human Description:
COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) [Source:HGNC Symbol;Acc:24335]
Mouse Orthologue:
Cops8
Mouse Description:
COP9 (constitutive photomorphogenic) homolog, subunit 8 (Arabidopsis thaliana) Gene [Source:MGI Symb

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34638 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034686 Nonsense 107 191 4 7

The following transcripts of ENSDARG00000024846 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24929943)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24085729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGCTGCTTACCAGTGGTCTGAAAGCATTCTCCCTGTGATGGAAGCTT[T/A]AAGAGGTACTGTCATATGGCTTAGGTTTTTATGCTATATTCTGGGTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link