crhbp

Ensembl ID:
ENSDARG00000024831
ZFIN ID:
ZDB-GENE-040801-196
Description:
corticotropin-releasing factor-binding protein [Source:RefSeq peptide;Acc:NP_001003459]
Human Orthologue:
CRHBP
Human Description:
corticotropin releasing hormone binding protein [Source:HGNC Symbol;Acc:2356]
Mouse Orthologue:
Crhbp
Mouse Description:
corticotropin releasing hormone binding protein Gene [Source:MGI Symbol;Acc:MGI:88497]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32332 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030579 Nonsense 107 321 3 7
Genomic Location (Zv9):
Chromosome 21 (position 7099405)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7220719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTACTGACGTTATCAGCATCGAGTATGATTCGGTCAACATCGACTGC[A/T]GAGGAGGAGATTTCATTAAGGTATACTGTTCATAATCCATTTGAATCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link