tnw

Ensembl ID:
ENSDARG00000024829
ZFIN ID:
ZDB-GENE-990415-262
Description:
tenascin W [Source:RefSeq peptide;Acc:NP_571111]
Human Orthologue:
TNN
Human Description:
tenascin N [Source:HGNC Symbol;Acc:22942]
Mouse Orthologue:
Tnn
Mouse Description:
tenascin N Gene [Source:MGI Symbol;Acc:MGI:2665790]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1797 Missense F2 line generated During 2014
sa19810 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1797
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029006 Missense 11 844 2 14
ENSDART00000077178 Missense 11 932 2 15
ENSDART00000123700 Missense 11 504 2 15
ENSDART00000125298 Missense 11 930 2 17

The following transcripts of ENSDARG00000024829 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 35277072)
KASP Assay ID:
554-1789.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTTTCTTTCAGAAACCATGGCCGTTAGATTAAACCGGCTGAAAAGAG[G/T]CCTTTTTCTACTGGGGACGCTCTTTATGGTGTCCCAYATTGTGCTCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029006 Essential Splice Site 610 844 9 14
ENSDART00000077178 Essential Splice Site 698 932 10 15
ENSDART00000123700 Essential Splice Site None 504 10 15
ENSDART00000125298 Essential Splice Site 698 930 10 17

The following transcripts of ENSDARG00000024829 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 35237281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAGAGGCTCAAAGAGGAGTAAAATAGTGGAGACAACATTCAGTACAG[G/A]TAGAGTTGAACAATATATCAATTGAGCATTGATATCGCAACATGTGAACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jqkblilq