rnf150

Ensembl ID:
ENSDARG00000024827
ZFIN ID:
ZDB-GENE-060213-1
Description:
RING finger protein 150 [Source:RefSeq peptide;Acc:NP_001139044]
Human Orthologue:
RNF150
Human Description:
ring finger protein 150 [Source:HGNC Symbol;Acc:23138]
Mouse Orthologue:
Rnf150
Mouse Description:
ring finger protein 150 Gene [Source:MGI Symbol;Acc:MGI:2443860]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1966 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa1966
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035713 Essential Splice Site 257 418 4 7
Genomic Location (Zv9):
Chromosome 1 (position 53788929)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52658500
KASP Assay ID:
554-2452.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCATACCTTTTTTTTATCCTTCGTATCGCCCTTTTTATTGACTTTTCT[A/G]GGAAACAGATTCAGACTTTGACAACTGTGCGGTGTGTATTGAAGACTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link