si:busm1-6a2.1

Ensembl ID:
ENSDARG00000024815
ZFIN IDs:
ZDB-GENE-030616-523, ZDB-GENE-030616-523
Description:
hypothetical protein LOC368398 [Source:RefSeq peptide;Acc:NP_001068572]
Human Orthologue:
OGFR
Human Description:
opioid growth factor receptor [Source:HGNC Symbol;Acc:15768]
Mouse Orthologue:
Ogfr
Mouse Description:
opioid growth factor receptor Gene [Source:MGI Symbol;Acc:MGI:1919325]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21888 Nonsense Available for shipment Available now
sa21887 Essential Splice Site Available for shipment Available now
sa11752 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030420 Nonsense 244 410 9 13
ENSDART00000080687 Nonsense 233 329 9 9
Genomic Location (Zv9):
Chromosome 11 (position 20513163)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19930477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTTTCCTCCATGAGACTTTGTTTCAAGGACAACTTAAGAATGTCAAA[C/T]AAAGTGTACTAGATTACTTTATGTTTGCAGTTTTGGACAAATCAAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030420 Essential Splice Site 405 410 11 13
ENSDART00000080687   None 329 9 9
Genomic Location (Zv9):
Chromosome 11 (position 20512674)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19929988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATGAAGTCCACATGACACCACAAAATAAACCTAATGGTAATTCTGAT[G/T]AAAGTAATCTAGCTGAAATTAGGAAAACTAATGAAAATGACATGCTAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030420 Essential Splice Site 407 410 None 13
ENSDART00000080687   None 329 9 9
Genomic Location (Zv9):
Chromosome 11 (position 20512434)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19929748
KASP Assay ID:
2260-4180.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGRTGAAGATGAAAGTAATCTAAATAATACAGCGTATACTAAAGAAATG[T/C]CAGCWGAACATGAGCAGGGATCAAAWAATGAAAACAGTCAGTGCAACTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link