mxc

Ensembl ID:
ENSDARG00000024789
ZFIN ID:
ZDB-GENE-030721-7
Description:
Interferon-induced GTP-binding protein MxC [Source:UniProtKB/Swiss-Prot;Acc:Q6DKF0]
Human Orthologues:
AC019294.4, MX1, MX2
Human Descriptions:
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) [Source:HGNC Symb
myxovirus (influenza virus) resistance 2 (mouse) [Source:HGNC Symbol;Acc:7533]
Putative UPF0621 protein C [Source:UniProtKB/Swiss-Prot;Acc:A8MV40]
Mouse Orthologues:
Mx1, Mx2
Mouse Descriptions:
myxovirus (influenza virus) resistance 1 Gene [Source:MGI Symbol;Acc:MGI:97243]
myxovirus (influenza virus) resistance 2 Gene [Source:MGI Symbol;Acc:MGI:97244]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa400 Nonsense Available for shipment Available now
sa15389 Essential Splice Site Available for shipment Available now
sa16589 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012694 Nonsense 54 626 1 11
Genomic Location:
Chromosome 9 (position 33846313)
KASP Assay ID:
554-0263.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAAGGACCTGAACCTGCCTGCTATTGCTGTCATCGGTGACCAGAGCT[C/A]AGGAAAGAGTTCAGTGCTGGAAGCCCTGTCTGGAGTGGCGCTGCCGCGGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012694 Essential Splice Site 447 626 9 11
Genomic Location:
Chromosome 9 (position 33841821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTWGAGGACCTGGAAGAACCTGCTTTAAAGCTGCTTAGAAATGCCAAAG[G/A]TTGAWAACAATGTTTAATAGCAAACAAAATGTAGCACCTTTAAAAACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012694 Nonsense 561 626 11 11
Genomic Location:
Chromosome 9 (position 33839739)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGYAGATTGCCTGTGAGCGTCTGGCTAACCAGATTCCRCTGATAGTC[C/T]AGTATCACATGATGAACGAGTACAACTCTCAGCTTCAGAATGCAATGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ura000ub