mxc

Ensembl ID:
ENSDARG00000024789
ZFIN ID:
ZDB-GENE-030721-7
Description:
Interferon-induced GTP-binding protein MxC [Source:UniProtKB/Swiss-Prot;Acc:Q6DKF0]
Human Orthologues:
AC019294.4, MX1, MX2
Human Descriptions:
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) [Source:HGNC Symb
myxovirus (influenza virus) resistance 2 (mouse) [Source:HGNC Symbol;Acc:7533]
Putative UPF0621 protein C [Source:UniProtKB/Swiss-Prot;Acc:A8MV40]
Mouse Orthologues:
Mx1, Mx2
Mouse Descriptions:
myxovirus (influenza virus) resistance 1 Gene [Source:MGI Symbol;Acc:MGI:97243]
myxovirus (influenza virus) resistance 2 Gene [Source:MGI Symbol;Acc:MGI:97244]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa400 Nonsense Available for shipment Available now
sa41459 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15389 Essential Splice Site Available for shipment Available now
sa16589 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012694 Nonsense 54 626 1 11
Genomic Location (Zv9):
Chromosome 9 (position 33846313)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33002259
KASP Assay ID:
554-0263.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAAGGACCTGAACCTGCCTGCTATTGCTGTCATCGGTGACCAGAGCT[C/A]AGGAAAGAGTTCAGTGCTGGAAGCCCTGTCTGGAGTGGCGCTGCCGCGGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa41459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012694 Essential Splice Site 217 626 4 11
Genomic Location (Zv9):
Chromosome 9 (position 33844546)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33000492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGAAGATGGCATCCACAGTCGACCCAACTGGACAAAGGACTTTATG[T/C]ATGTTACGTTACATGTACAGTAGGCTGATATTTTGCTAAATTCAATGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012694 Essential Splice Site 447 626 9 11
Genomic Location (Zv9):
Chromosome 9 (position 33841821)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32997767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTWGAGGACCTGGAAGAACCTGCTTTAAAGCTGCTTAGAAATGCCAAAG[G/A]TTGAWAACAATGTTTAATAGCAAACAAAATGTAGCACCTTTAAAAACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012694 Nonsense 561 626 11 11
Genomic Location (Zv9):
Chromosome 9 (position 33839739)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32995685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGYAGATTGCCTGTGAGCGTCTGGCTAACCAGATTCCRCTGATAGTC[C/T]AGTATCACATGATGAACGAGTACAACTCTCAGCTTCAGAATGCAATGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link