ctnna2

Ensembl ID:
ENSDARG00000024785
ZFIN ID:
ZDB-GENE-060815-3
Description:
Catenin alpha-2 [Source:UniProtKB/Swiss-Prot;Acc:B7ZC77]
Human Orthologue:
CTNNA2
Human Description:
catenin (cadherin-associated protein), alpha 2 [Source:HGNC Symbol;Acc:2510]
Mouse Orthologue:
Ctnna2
Mouse Description:
catenin (cadherin associated protein), alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88275]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3343 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16103 Nonsense Available for shipment Available now
sa4860 Nonsense Mutation detected in F1 DNA During 2014
sa2006 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa3343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017139 Essential Splice Site 35 352 3 7
ENSDART00000101306 Essential Splice Site 35 865 3 17
ENSDART00000101311 Essential Splice Site 35 293 3 7
ENSDART00000110860 Essential Splice Site 35 373 2 7
ENSDART00000138740 Essential Splice Site 35 430 3 9
ENSDART00000143871 Essential Splice Site 22 271 2 5

The following transcripts of ENSDARG00000024785 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 42757425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGWAGCCTTTGTACACAACAATCTTCATAGTTTGACTCTTTTTGTCCAC[A/T]GGTGACCACCCTGGTCAACACCWGCAACAAAGGCCCGTCCAGTAAGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16103
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017139 None None 352 None 7
ENSDART00000101306 Nonsense 396 865 9 17
ENSDART00000101311 None None 293 None 7
ENSDART00000110860 None None 373 None 7
ENSDART00000138740 None None 430 None 9
ENSDART00000143871 None None 271 None 5

The following transcripts of ENSDARG00000024785 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 43362451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCACCAACATCATWCTTTCTGTGTTTTTCAGGTGGCCAACCTCGCCTG[T/A]TCCATCTCCAACAATGAGGAGGGGGTGAAGYTAGTGCGCATGGCTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017139 None None 352 None 7
ENSDART00000101306 Nonsense 585 865 12 17
ENSDART00000101311 None None 293 None 7
ENSDART00000110860 None None 373 None 7
ENSDART00000138740 None None 430 None 9
ENSDART00000143871 None None 271 None 5

The following transcripts of ENSDARG00000024785 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 43392043)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCATCGATGCCTCTCGCCTCGTCTACGATGGAGTGCGTGACAKCAGG[A/T]AAGCAGTCCTCATGATAAGAGTGAGTAATGGCCAAATAAAACCCCCRAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2006
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017139 None None 352 None 7
ENSDART00000101306 Nonsense 646 865 14 17
ENSDART00000101311 None None 293 None 7
ENSDART00000110860 None None 373 None 7
ENSDART00000138740 None None 430 None 9
ENSDART00000143871 None None 271 None 5
ENSDART00000017139 None None 352 None 7
ENSDART00000101306 Nonsense 646 865 14 17
ENSDART00000101311 None None 293 None 7
ENSDART00000110860 None None 373 None 7
ENSDART00000138740 None None 430 None 9
ENSDART00000143871 None None 271 None 5

The following transcripts of ENSDARG00000024785 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 43405283)
KASP Assay ID:
554-3244.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCCATCATGGCTCAGCTGCCTCAGGAAGAAAAGGCCAAGATTGCTGAA[C/T]AGGTCGAGAGCTTCAGGCAGGAAAAGAGCAAGCTGGACGCTGAAGTCGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4i6ld1wy