ctnna2

Ensembl ID:
ENSDARG00000024785
ZFIN ID:
ZDB-GENE-060815-3
Description:
Catenin alpha-2 [Source:UniProtKB/Swiss-Prot;Acc:B7ZC77]
Human Orthologue:
CTNNA2
Human Description:
catenin (cadherin-associated protein), alpha 2 [Source:HGNC Symbol;Acc:2510]
Mouse Orthologue:
Ctnna2
Mouse Description:
catenin (cadherin associated protein), alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88275]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16103 Nonsense Available for shipment Available now
sa32731 Nonsense Mutation detected in F1 DNA During 2016
sa2006 Nonsense F2 line generated During 2016
sa32732 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16103
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017139   None 352 None 7
ENSDART00000101306 Nonsense 396 865 9 17
ENSDART00000101311   None 293 None 7
ENSDART00000110860   None 373 None 7
ENSDART00000138740   None 430 None 9
ENSDART00000143871   None 271 None 5

The following transcripts of ENSDARG00000024785 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 43362451)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 42278767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCACCAACATCATWCTTTCTGTGTTTTTCAGGTGGCCAACCTCGCCTG[T/A]TCCATCTCCAACAATGAGGAGGGGGTGAAGYTAGTGCGCATGGCTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017139   None 352 None 7
ENSDART00000101306 Nonsense 414 865 9 17
ENSDART00000101311   None 293 None 7
ENSDART00000110860   None 373 None 7
ENSDART00000138740   None 430 None 9
ENSDART00000143871   None 271 None 5

The following transcripts of ENSDARG00000024785 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 43362503)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 42278819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCTCCAACAATGAGGAGGGGGTGAAGTTAGTGCGCATGGCTGCTACA[C/T]AGATCGATAGCCTGTGTCCTCAGGTAAAAAGGCCAGAACCTTCTGCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2006
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017139   None 352 None 7
ENSDART00000101306 Nonsense 646 865 14 17
ENSDART00000101311   None 293 None 7
ENSDART00000110860   None 373 None 7
ENSDART00000138740   None 430 None 9
ENSDART00000143871   None 271 None 5
ENSDART00000017139   None 352 None 7
ENSDART00000101306 Nonsense 646 865 14 17
ENSDART00000101311   None 293 None 7
ENSDART00000110860   None 373 None 7
ENSDART00000138740   None 430 None 9
ENSDART00000143871   None 271 None 5

The following transcripts of ENSDARG00000024785 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 43405283)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 42321599
KASP Assay ID:
554-3244.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCCATCATGGCTCAGCTGCCTCAGGAAGAAAAGGCCAAGATTGCTGAA[C/T]AGGTCGAGAGCTTCAGGCAGGAAAAGAGCAAGCTGGACGCTGAAGTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017139   None 352 None 7
ENSDART00000101306 Nonsense 677 865 14 17
ENSDART00000101311   None 293 None 7
ENSDART00000110860   None 373 None 7
ENSDART00000138740   None 430 None 9
ENSDART00000143871   None 271 None 5

The following transcripts of ENSDARG00000024785 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 43405376)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 42321692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCGCTAAGTGGGATGACAATGGAAATGACATCATCGTGTTGGCTAAG[C/T]AGATGTGTATGATCATGATGGAGATGACTGACTTCACCAGGTACATCCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link