inhbab

Ensembl ID:
ENSDARG00000024759
ZFIN ID:
ZDB-GENE-050525-2
Description:
inhibin, beta Ab [Source:RefSeq peptide;Acc:NP_001018166]
Human Orthologue:
INHBA
Human Description:
inhibin, beta A [Source:HGNC Symbol;Acc:6066]
Mouse Orthologue:
Inhba
Mouse Description:
inhibin beta-A Gene [Source:MGI Symbol;Acc:MGI:96570]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18171 Nonsense Available for shipment Available now
hu3519 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa18171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047468 Nonsense 169 405 2 2
Genomic Location:
Chromosome 2 (position 21298261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCAGCACACTGTCAGTGGTGGAGCAGGCCAACGTCTGGCTGTTCCTC[A/T]AAGTAGCCAAGGGCAGCCGAGTGAAGGGAAAAGTATCCGTTCAGCTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3519
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047468 Nonsense 317 405 2 2
Genomic Location:
Chromosome 2 (position 21298707)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAGCGCCAGTTCTACGTCAACTTCAAGGACATCGGGTGGAGCGACTG[G/A]ATCATCGCTCCATCTGGTTATCACGCTAACTACTGCGAGGGCGACTGTCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/23xejt4t