si:ch211-165e15.1

Ensembl ID:
ENSDARG00000024748
ZFIN ID:
ZDB-GENE-081028-59
Description:
Novel protein similar to vertebrate dystonin (DST) [Source:UniProtKB/TrEMBL;Acc:B8A457]
Human Orthologue:
DST
Human Description:
dystonin [Source:HGNC Symbol;Acc:1090]
Mouse Orthologue:
Dst
Mouse Description:
dystonin Gene [Source:MGI Symbol;Acc:MGI:104627]

Alleles

There are 19 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42113 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38913 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42114 Nonsense Mutation detected in F1 DNA During 2017
sa15356 Nonsense Available for shipment Available now
sa35396 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42115 Nonsense Mutation detected in F1 DNA During 2017
sa14777 Nonsense Available for shipment Available now
sa12257 Nonsense Available for shipment Available now
sa16177 Essential Splice Site Available for shipment Available now
sa35397 Nonsense Mutation detected in F1 DNA During 2017
sa10442 Essential Splice Site Available for shipment Available now
sa11822 Nonsense Available for shipment Available now
sa22196 Nonsense Mutation detected in F1 DNA During 2017
sa42116 Nonsense Mutation detected in F1 DNA During 2017
sa11890 Nonsense Available for shipment Available now
sa22197 Essential Splice Site Available for shipment Available now
sa35398 Nonsense Mutation detected in F1 DNA During 2017
sa42117 Nonsense Mutation detected in F1 DNA During 2017
sa42118 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Essential Splice Site 22 7146 None 125
ENSDART00000133961 Essential Splice Site 223 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1355956)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1353308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCAGAAGAAGACTTTCACCAAATGGATCAATCAGCACCTCTTAAAGG[T/C]ACAGTACATCCGATTTGCTTGTTAATGTGGAAGAGTGAAGAGTGTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Essential Splice Site 78 7146 3 125
ENSDART00000133961 Essential Splice Site 279 310 7 8
Genomic Location (Zv9):
Chromosome 13 (position 1365843)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1363195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGACTCCAGAATGTACAGATCGCACTCGACTACTTAAAAAGACGCCAG[G/A]TAAGAAGAATAATCAACGCTGCAGTCTGATTTCATGCCTTTAAAGGGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Nonsense 99 7146 4 125
ENSDART00000133961 Nonsense 300 310 8 8
Genomic Location (Zv9):
Chromosome 13 (position 1369312)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1366664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACATCAGGAACGACGACATAACAGATGGAAACCCAAAGCTGACACTG[G/T]GATTAATATGGACCATAATTCTGCACTTTCAGGTGAGTCTGGACTTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Nonsense 829 7146 23 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1408764)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1405934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCAGATCACCATCGGCAAAGAGGACGAGTGTGTTCTGGTGAGCAACT[C/A]GCACAGAGCCAAGTGGAAAGTCATCAGTMCGTCTGGAAATGAGGCCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Essential Splice Site 1131 7146 28 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1414911)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1412081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAAATGCCAACATCAAGTCTATCGATGGAGTCGTGAGCACTCTTAAGG[T/C]AATACACTCCCGTTATCATGGTAAACATGCATTTCTTTAATGACCTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Nonsense 2028 7146 41 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1433371)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1430541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCAATGCACACAGTGAACCCTGAATGTAAAGATGTCATTCAAGACCAA[G/T]AATCCTCATCAATATTTCCTTCTGAGGCAATTAGCTATACAGAAATGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Nonsense 2380 7146 43 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1434776)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1431946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGATATTAAGCATGCATCTACCGAAAAAGCAAGTGTAAGCAGTAGTT[T/A]GGAGCTCTATTTAMAGTCCAATTCTGAYATTCACTCTAAAACTTCTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12257
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Nonsense 2464 7146 46 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1435325)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1432495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGTTRCACAAGTTAGTTCACTCACCGAACCACAGTCAGACYTGTCTT[T/A]GTGTGGTGCAAATSCTCAGCCAMMAATTGAGACAACAGAGGTCAGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Essential Splice Site 2478 7146 47 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1435746)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1432916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KATACAGYAGTTAATGAAGTTGCTYACCAGGGYGACCTTGATTTACCTCA[T/A]AWATCAAAGGYCACAGATGCATGTTCTCCAAAATCAATGGGAGGAAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Nonsense 2507 7146 47 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1435835)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1433005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGGAAGTGTTTTAAGATCTACCTTAAATGAGTTAAGCCTAATGAAGT[T/A]GGATGTTGGAAGTGTGGATGATACTCAAAAACAAAAAGTGGAGTTTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Essential Splice Site 3410 7146 58 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1444038)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1441208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACGCCATTCATTTGTGCTTATTTGYGCCCCAAAWATGAACATTTGTGC[T/A]GGATTGGTGATATGAAACCTTAKTTTYTGGACTGTGTGAYGTYACTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Nonsense 3417 7146 58 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1444061)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1441231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGYGCCCCAAAWATGAACATTTGTGCWGGATTGGTGATATGAAACCTTA[T/G]TTTYTGGACTGTGTGAYGTYACTCTTCACCCCACGTTGCTCWAAGAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Nonsense 4120 7146 70 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1462914)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1460084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGTTCTTAAAAGACATTTGCTGGTCTTTTCCTTCTGTCTGCAGGACT[T/A]GCTGGACGCCTGGACCTCCAAATCTCCCGCGGTCCAGGATATAAATAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Nonsense 4535 7146 76 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1470596)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1467766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATGTAACAATGTTATATTTCATCTTGTGTTCGCCAGCTAAGCGGATC[G/T]AGCAGCTCAACTCGGCTTTCGCCAGCTCTCAGCAGTTCCACCAGACATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11890
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Nonsense 4667 7146 76 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1470993)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1468163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAGGGCACTGAAATACAAGGAGAACGCTGAGAAGCTGAACTCGTGGT[T/A]GCAGGAGTGTGAAGACACGGAGAASACGGTGAAGCTCAGCGTAAGCTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Essential Splice Site 5020 7146 76 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1472055)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1469225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCGGATTGGAAACAGAAGTCATTAATCAGCAACTGGAGTCCTTCAAGG[T/A]AAGATTTGATGTGTTGTAGCGATCTGACTGGGTAGAGGTGCCAACCTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Nonsense 5560 7146 86 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1517264)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1514729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAACATTCACACAGCTTTCACAGCCCGCTATTGAGTATGAAGCCCTG[C/T]GACAGCAACAGGAGGAGCTCAGGGTAAGACACACACATGTGGCAAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Nonsense 6330 7146 102 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1540236)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1536378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGGACACTGAGTTGGAGATCGCCAACGACCCAGACAAGATCAAGACA[C/T]AGTTGACCCAGCACAAGGTGACTGACTGACACACAGAGTCTGTTTAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092780 Essential Splice Site 6504 7146 105 125
ENSDART00000133961   None 310 None 8
Genomic Location (Zv9):
Chromosome 13 (position 1555268)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1551408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCGCTGGGAGACGGTCTGCAGCCTCTCCGTGTCCAAACAGACACGCCT[G/A]GAGCAGGCCCTCAGTCAGGTAACACTGGTCACAATCACTTACTATTTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link