hsp90a.2

Ensembl ID:
ENSDARG00000024746
ZFIN ID:
ZDB-GENE-031001-3
Description:
heat shock protein 90-alpha 2 [Source:RefSeq peptide;Acc:NP_001038538]
Human Orthologues:
HSP90AB1, HSP90AB4P
Human Descriptions:
heat shock protein 90kDa alpha (cytosolic), class B member 1 [Source:HGNC Symbol;Acc:5258]
heat shock protein 90kDa alpha (cytosolic), class B member 4 (pseudogene) [Source:HGNC Symbol;Acc:32
Mouse Orthologue:
Hsp90ab1
Mouse Description:
heat shock protein 90 alpha (cytosolic), class B member 1 Gene [Source:MGI Symbol;Acc:MGI:96247]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1808 Missense F2 line generated During 2017

Mutation Details

Allele Name:
sa1808
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023550 Missense 469 734 8 11
Genomic Location (Zv9):
Chromosome 20 (position 54326201)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54181604
KASP Assay ID:
554-1800.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGACTCGCAGAACAGAAAGAAACTGTCAGAGCTGCTGCGCTACTACA[C/A]ATCCGCTTCAGGAGACGAGATGGTGTCGCTCAAAGATTACGTCACACGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link