dpp6b

Ensembl ID:
ENSDARG00000024744
ZFIN ID:
ZDB-GENE-070705-88
Description:
dipeptidyl-peptidase 6 [Source:RefSeq peptide;Acc:NP_001108594]
Human Orthologue:
DPP6
Human Description:
dipeptidyl-peptidase 6 [Source:HGNC Symbol;Acc:3010]
Mouse Orthologue:
Dpp6
Mouse Description:
dipeptidylpeptidase 6 Gene [Source:MGI Symbol;Acc:MGI:94921]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25100 Nonsense Mutation detected in F1 DNA During 2017
sa14761 Essential Splice Site Available for shipment Available now
sa19693 Essential Splice Site Available for shipment Available now
sa31263 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037848 Nonsense 282 857 8 26
ENSDART00000132122 Nonsense 282 821 8 25
Genomic Location (Zv9):
Chromosome 2 (position 12235047)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12760272
KASP Assay ID:
554-7403.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACAGGCAGTCTGGGGGTCATATTTAATGGACTTGCTGACTGGCTCTA[T/A]GAAGGTAAAACCCATAAACATTAATAATAAAAACAACACAGTGGACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037848 Essential Splice Site 410 857 11 26
ENSDART00000132122 Essential Splice Site 410 821 11 25
Genomic Location (Zv9):
Chromosome 2 (position 12224655)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12749880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTCAATTCTGACCTTATGTGAGGCCACTACTGGCATCTGCACAAAGG[T/G]AACTGGCAATCAGCCTTATTCACTAKTTTAAACATTTTACAATAATARTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037848 Essential Splice Site 490 857 15 26
ENSDART00000132122 Essential Splice Site 454 821 14 25
Genomic Location (Zv9):
Chromosome 2 (position 12217381)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12742606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTGGTAATGTAACAATAATAGATATTTATGACAACAATGTCTTTGCA[G/A]ATACTTTTTGAGCACAGAAGACGGTGCAAGTCGGCGTCAGCTTTACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037848 Nonsense 559 857 17 26
ENSDART00000132122 Nonsense 523 821 16 25
Genomic Location (Zv9):
Chromosome 2 (position 12212403)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12737628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAGGTCCCGGTGTGCCTCACTCAGCCGTGTACAGCACCAGATATGGA[C/T]AGTATGAGAGTGAGTCTTCTGTTTCTTACTGCACTTAAACACTATCAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link