hdhd2

Ensembl ID:
ENSDARG00000024728
ZFIN ID:
ZDB-GENE-050320-37
Description:
Haloacid dehalogenase-like hydrolase domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5
Human Orthologue:
HDHD2
Human Description:
haloacid dehalogenase-like hydrolase domain containing 2 [Source:HGNC Symbol;Acc:25364]
Mouse Orthologue:
Hdhd2
Mouse Description:
haloacid dehalogenase-like hydrolase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1924237]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9783 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039161 Nonsense 189 204 4 4
Genomic Location:
Chromosome 10 (position 14560883)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGRCCACAGTTGTGGGTAAACCAGAGAAAGGCTTCTTTCTAGAGGCCT[T/A]GCGAGATCTCARCTGCTCACCAGAGGAGGCTGTGATGRTCGGAGATGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/scav1rid