selenbp1

Ensembl ID:
ENSDARG00000024717
ZFIN ID:
ZDB-GENE-040426-1436
Description:
Selenium-binding protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6PHD9]
Human Orthologue:
SELENBP1
Human Description:
selenium binding protein 1 [Source:HGNC Symbol;Acc:10719]
Mouse Orthologues:
Selenbp1, Selenbp2
Mouse Descriptions:
selenium binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:96825]
selenium binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:104859]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4676 Nonsense F2 line generated During 2017
sa22914 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4676
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030795 Nonsense 220 457 6 12
ENSDART00000131694 Nonsense 220 473 6 12
Genomic Location (Zv9):
Chromosome 16 (position 40813429)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38198229
KASP Assay ID:
554-3528.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGGGAGCGCCTAAAGCACWGGGAAATGGCTTCWACCCTGCTGACGTC[A/T]AAGCTGGTATGTGCGCATTCAAGAGTGTTCTGTGAAGAGATGGCAGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030795 Nonsense 446 457 12 12
ENSDART00000131694 Nonsense 462 473 12 12
Genomic Location (Zv9):
Chromosome 16 (position 40822229)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38207029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTCGGAGCGGAGCCAGAAGGTCCTGCACTCGCCCATGAGCTCCGGTA[T/A]CCTGGCGGAGACTGTACTTCTGATATCTGGCTATAAAGCTTGGAGCAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link