si:dkey-204f11.59

Ensembl ID:
ENSDARG00000024708
ZFIN ID:
ZDB-GENE-040724-220
Description:
solute carrier family 25, member 23 [Source:RefSeq peptide;Acc:NP_001038417]
Human Orthologues:
SLC25A23, SLC25A41
Human Descriptions:
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 [Source:HGNC Symbol;A
solute carrier family 25, member 41 [Source:HGNC Symbol;Acc:28533]
Mouse Orthologues:
Slc25a23, Slc25a41
Mouse Descriptions:
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 Gene [Source:MGI Symb
solute carrier family 25, member 41 Gene [Source:MGI Symbol;Acc:MGI:2144215]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20065 Nonsense Available for shipment Available now
sa40107 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030530 Nonsense 324 478 9 11
ENSDART00000145859 Nonsense 327 481 8 10
Genomic Location (Zv9):
Chromosome 3 (position 34312933)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34098129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTTCTGTTTCTCAGGTGTTGAAGACCCGTTTGACCCTTCGGAAGACT[G/T]GACAGTATTCTGGCATGGCAGACTGTGCCAAGCAGATACTGCGTAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030530 Nonsense 374 478 10 11
ENSDART00000145859 Nonsense 377 481 9 10
Genomic Location (Zv9):
Chromosome 3 (position 34315416)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34100612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAAAGTATATCTATAACCCTGTTCTCTCAGACACTGAAGAACGCTTG[G/A]CTCCAGCGGTACTGTATGGGCTCGGCTGATCCAGGAGTTCTGGTGCTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link