parn

Ensembl ID:
ENSDARG00000024702
ZFIN ID:
ZDB-GENE-040426-880
Description:
Poly(A)-specific ribonuclease PARN [Source:UniProtKB/Swiss-Prot;Acc:Q7ZU92]
Human Orthologue:
PARN
Human Description:
poly(A)-specific ribonuclease (deadenylation nuclease) [Source:HGNC Symbol;Acc:8609]
Mouse Orthologue:
Parn
Mouse Description:
poly(A)-specific ribonuclease (deadenylation nuclease) Gene [Source:MGI Symbol;Acc:MGI:1921358]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32813 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030873 Essential Splice Site 232 660 10 26
Genomic Location (Zv9):
Chromosome 1 (position 60295249)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58612946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGGTATTCTAAAGGTCTTCATGTGGAGACGCTGGAGACTGAGAAGG[T/C]ACGAACACACACACACGCACAGGAATACACACTATATCAAAACACACTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link