myo1bl2

Ensembl ID:
ENSDARG00000024694
ZFIN ID:
ZDB-GENE-030131-695
Description:
Myo1bl2 protein [Source:UniProtKB/TrEMBL;Acc:B5DDQ9]
Human Orthologue:
MYO1B
Human Description:
myosin IB [Source:HGNC Symbol;Acc:7596]
Mouse Orthologue:
Myo1b
Mouse Description:
myosin IB Gene [Source:MGI Symbol;Acc:MGI:107752]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14798 Essential Splice Site Available for shipment Available now
sa5531 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037459 Essential Splice Site 137 1081 None 29
ENSDART00000077187 None None 251 None 10
ENSDART00000138204 None None 855 None 21
ENSDART00000142974 None None 142 None 5

The following transcripts of ENSDARG00000024694 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 16411507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTACCCYTGTCTTAYTGTTACTGTTAAACTCTAMTTGTAATTGTATTTC[A/T]GAAAAACTGAAGCTGGACCGGGACTTCAGCAAATATAACTACCTTAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037459 Essential Splice Site 510 1081 14 29
ENSDART00000077187 None None 251 None 10
ENSDART00000138204 Essential Splice Site 339 855 8 21
ENSDART00000142974 None None 142 None 5

The following transcripts of ENSDARG00000024694 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 16437072)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGAACACTCATGAAAAACCTGCTGACCAAAAACCCTAACTATATCAGG[T/G]AAAGCTCAAAAATTAATCATAATGTTAGAATTAATTATATTTTTGGGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lf1xtu0u