myo1bl2

Ensembl ID:
ENSDARG00000024694
ZFIN ID:
ZDB-GENE-030131-695
Description:
Myo1bl2 protein [Source:UniProtKB/TrEMBL;Acc:B5DDQ9]
Human Orthologue:
MYO1B
Human Description:
myosin IB [Source:HGNC Symbol;Acc:7596]
Mouse Orthologue:
Myo1b
Mouse Description:
myosin IB Gene [Source:MGI Symbol;Acc:MGI:107752]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14798 Essential Splice Site Available for shipment Available now
sa5531 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34595 Nonsense Mutation detected in F1 DNA During 2016
sa34596 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037459 Essential Splice Site 137 1081 None 29
ENSDART00000077187   None 251 None 10
ENSDART00000138204   None 855 None 21
ENSDART00000142974   None 142 None 5

The following transcripts of ENSDARG00000024694 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 16411507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTACCCYTGTCTTAYTGTTACTGTTAAACTCTAMTTGTAATTGTATTTC[A/T]GAAAAACTGAAGCTGGACCGGGACTTCAGCAAATATAACTACCTTAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037459 Essential Splice Site 510 1081 14 29
ENSDART00000077187   None 251 None 10
ENSDART00000138204 Essential Splice Site 339 855 8 21
ENSDART00000142974   None 142 None 5

The following transcripts of ENSDARG00000024694 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 16437072)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGAACACTCATGAAAAACCTGCTGACCAAAAACCCTAACTATATCAGG[T/G]AAAGCTCAAAAATTAATCATAATGTTAGAATTAATTATATTTTTGGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037459 Nonsense 631 1081 17 29
ENSDART00000077187   None 251 None 10
ENSDART00000138204 Nonsense 460 855 11 21
ENSDART00000142974 Nonsense 24 142 1 5

The following transcripts of ENSDARG00000024694 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 16446644)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGGAGACAGTGCCTTGAGGACTTGGCAGCACTCATCCAGAAGATCTA[C/A]CGTGGCTGGAAATGTCGCACTCACTTTCTCCTTCTGAAAAAGAGCCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037459 Nonsense 807 1081 23 29
ENSDART00000077187   None 251 4 10
ENSDART00000138204 Nonsense 578 855 15 21
ENSDART00000142974   None 142 None 5

The following transcripts of ENSDARG00000024694 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 16453686)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACTGAACAATTGTTTTACAGGTTCGTCGGGAGTACAGGAAGTTCTTC[A/T]GAGCTAATGCTGGCAAGAAGATCTATGACTTCACCATCCAGAGAATTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link