NLRC5

Ensembl ID:
ENSDARG00000024631
Description:
NLR family, CARD domain containing 5 [Source:HGNC Symbol;Acc:29933]
Human Orthologue:
NLRC5
Human Description:
NLR family, CARD domain containing 5 [Source:HGNC Symbol;Acc:29933]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23274 Nonsense Available for shipment Available now
sa23275 Nonsense Available for shipment Available now
sa6509 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43078 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15814 Nonsense Available for shipment Available now
sa17363 Nonsense Available for shipment Available now
sa29013 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033762 Nonsense 258 1746 3 43
Genomic Location (Zv9):
Chromosome 18 (position 17288597)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17640363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTGATCTCTCGAGACCTGTCCTTGAAAGAATTACTTTTTCTCTTCTA[T/A]CCTGCTTGTTCGTATGTTGAAGAAGAAAAAGAAGAAGTGTTTGCATTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033762 Nonsense 741 1746 5 43
Genomic Location (Zv9):
Chromosome 18 (position 17290421)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17642187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCAGTGGAGGCCTCACCGATGTTGGAGCGGCTAAACTTGCCAAGGCGT[T/A]GGAGGATTGTCCAAACATCACACACCTGAAGTAATACAGTTTGTTATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033762 Essential Splice Site 897 1746 11 43
Genomic Location (Zv9):
Chromosome 18 (position 17296499)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17648265
KASP Assay ID:
554-4579.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAATTTTGGACCTTCTGCCTAAACTAGGAGSAATTCAGGAGATWAAG[T/C]AAGCAAAACACTTCATCTGCAATTATTTTAGTCTGAACAGTAAGATGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033762 Essential Splice Site 963 1746 15 43
Genomic Location (Zv9):
Chromosome 18 (position 17297902)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17649668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTGTTTAAGAATCAATCAATAATTTCATACGTTGTTTTTGTTTTATT[A/G]GTTTAACCCATAGTGATATCCAACCTGCCTACATGACCAAGCTGTGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033762 Nonsense 1130 1746 21 43
Genomic Location (Zv9):
Chromosome 18 (position 17302589)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17654355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACKTATTGYGCCATTTAATACTTACTCCTTCACAGCCTCATTGGCAAC[C/T]GAATGACTCAAATCGGGGYACTGCATCTGGTCAACKCAATGAATACYTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033762 Nonsense 1334 1746 29 43
Genomic Location (Zv9):
Chromosome 18 (position 17306596)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17658362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCCACTTTCRTCACATTCTTYAGCTTTGATGACTGTGATGTAGAAGGA[C/T]AGCACCTCACTCAACTCGCACTTCCCATCCAGAAATGKCATGCCTTACWG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033762 Nonsense 1484 1746 34 43
Genomic Location (Zv9):
Chromosome 18 (position 17308810)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17660576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGTCTGTGGTACTCGACCAGGAGGGTATAAATATCCTAGCTCAAGGCT[T/A]GAGTCGACTGGCCTCACTTCGGAGGCTCAGGTAATGTTAGTTGTATATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)
  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link