si:ch211-206a7.2

Ensembl ID:
ENSDARG00000024619
ZFIN ID:
ZDB-GENE-060503-776
Description:
hypothetical protein LOC566899 [Source:RefSeq peptide;Acc:NP_001128604]
Human Orthologue:
FOXO6
Human Description:
forkhead box O6 [Source:HGNC Symbol;Acc:24814]
Mouse Orthologue:
Foxo6
Mouse Description:
forkhead box O6 Gene [Source:MGI Symbol;Acc:MGI:2676586]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36803 Nonsense Available for shipment Available now
sa36804 Nonsense Available for shipment Available now
sa18163 Nonsense Available for shipment Available now
sa36805 Nonsense Mutation detected in F1 DNA During 2017
sa43248 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028957 Nonsense 288 439 2 2
ENSDART00000131134 Nonsense 288 714 2 2
Genomic Location (Zv9):
Chromosome 19 (position 15050251)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15713855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGTGGATGCTTGTCTCCTATTCTGGCTGAGACAGAACCTGATGAACCA[G/T]AGGAAGGAGGACTTTCTTGTTCAGCCTCCCCACGACTCTACCCTAGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028957 Nonsense 418 439 2 2
ENSDART00000131134 Nonsense 418 714 2 2
Genomic Location (Zv9):
Chromosome 19 (position 15050641)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15714245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACAATGCCCTTGAAAGTTTGCTTGCTGGAGGGCCACAATACTGTGGT[A/T]AGGACATGGTTGTGGGGCAAGGAGGAACATCTCATTCACTTATGTCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028957 Nonsense 434 439 2 2
ENSDART00000131134 Nonsense 434 714 2 2
Genomic Location (Zv9):
Chromosome 19 (position 15050689)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15714293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAGGACATGGTTGTGGGGCAAGGAGGAACATCTCATTCACTTATGKCA[C/T]AATCTAATACTGCTGTGCATTCTCACGGCCACAATCAGAGCCACAATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028957   None 439 None 2
ENSDART00000131134 Nonsense 616 714 2 2
Genomic Location (Zv9):
Chromosome 19 (position 15051237)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15714841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCCAGGTTCCCACCTCCACCAGGGCATGACAGAACCCTGGCAGGGGTA[T/G]TACCACCACACATCACAGAATGCTAATTACCATGGAAACCACCAAGCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43248
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028957   None 439 None 2
ENSDART00000131134 Nonsense 704 714 2 2
Genomic Location (Zv9):
Chromosome 19 (position 15051499)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15715103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGGGAATGGGTTTGGGGATGGGAATGGGAGTTTTTGCAGGACCTCAA[C/T]AATCACACAATAGCCAGAGTTGGGTGCCTGGGTAAACCGAGGGGACATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link