pacsin3

Ensembl ID:
ENSDARG00000024587
ZFIN ID:
ZDB-GENE-040426-984
Description:
protein kinase C and casein kinase substrate in neurons 3 [Source:RefSeq peptide;Acc:NP_957283]
Human Orthologue:
PACSIN3
Human Description:
protein kinase C and casein kinase substrate in neurons 3 [Source:HGNC Symbol;Acc:8572]
Mouse Orthologue:
Pacsin3
Mouse Description:
protein kinase C and casein kinase substrate in neurons 3 Gene [Source:MGI Symbol;Acc:MGI:1891410]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41028 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044671 Essential Splice Site 70 377 4 11
ENSDART00000098296 Essential Splice Site 70 377 4 11
ENSDART00000134130   102 102 3 3
ENSDART00000141123   70 70 3 3
ENSDART00000143578   70 70 2 2
ENSDART00000147410   70 70 4 4
Genomic Location (Zv9):
Chromosome 7 (position 55060499)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53994011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCAGCTGAGCGACTGGGCTAGGAAATGGAGAGGCATTGTGGAGAAAG[G/A]TGAGTCTCAAAGGTCACCCTCTTTAGGCAGACCCATCCCGCCCTCTATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link