NP_001161738.1

Ensembl ID:
ENSDARG00000024560
Description:
solute carrier family 4 anion exchanger member 1b [Source:RefSeq peptide;Acc:NP_001161738]
Human Orthologue:
SLC4A1
Human Description:
solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood
Mouse Orthologue:
Slc4a1
Mouse Description:
solute carrier family 4 (anion exchanger), member 1 Gene [Source:MGI Symbol;Acc:MGI:109393]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19028 Nonsense Mutation detected in F1 DNA During 2017
sa35221 Nonsense Mutation detected in F1 DNA During 2017
sa14521 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078497 Nonsense 65 851 4 18
Genomic Location (Zv9):
Chromosome 12 (position 11142172)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10025243
KASP Assay ID:
2260-5029.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTCCTTTTTTTCATTTTTGTCTTGGATAAGGTGTGATGATGCTGGAC[A/T]GAGAGGAGAAGACGCTCTCCAGTATTATTGAGAAGATTGTGGATACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078497 Nonsense 215 851 8 18
Genomic Location (Zv9):
Chromosome 12 (position 11148076)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10031147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTCACACACAGGTATTTAACCAAGCAGCTTTCCAGGCTCAGAGTGAC[C/T]GAGAGCTCACAGATGCAGTGGGAGACTTTATGGACTGCTGCATCGTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078497 Nonsense 758 851 16 18
Genomic Location (Zv9):
Chromosome 12 (position 11177383)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10060454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTATTCAGCTTTGGGAYCGAATGCTGCTTCTTCTTATTCCCAAAAAGTA[T/G]CACCCYAATGAACCCTATGCTACAAGAGTATGTGAAGAACTTCTCACAKA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link