cryba4

Ensembl ID:
ENSDARG00000024548
ZFIN ID:
ZDB-GENE-050522-143
Description:
beta-crystallin A4 [Source:RefSeq peptide;Acc:NP_001018135]
Human Orthologue:
CRYBA4
Human Description:
crystallin, beta A4 [Source:HGNC Symbol;Acc:2396]
Mouse Orthologue:
Cryba4
Mouse Description:
crystallin, beta A4 Gene [Source:MGI Symbol;Acc:MGI:102716]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38813 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18530 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046172 Essential Splice Site 30 164 3 5
Genomic Location:
Chromosome 10 (position 45549865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGACTTTGCGCTTGAAATCTTTAAAGGTGCCCAACCTCTGTCTTCCA[G/T]ATCATCGTGTATGATGAGGAGTGCTTCCAGGGCCGTCATCATGAGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046172 Nonsense 105 164 4 5
Genomic Location:
Chromosome 10 (position 45552140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAATATCCTCAGTGCGACTCCTTTGGAGGAAGCAATGCTTACCACATC[G/T]AGAGAATGACCTCCTTTAGACCAATCTCCTGCGCCGTAAGTYCAGCTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link