cpla2

Ensembl ID:
ENSDARG00000024546
ZFIN ID:
ZDB-GENE-990415-45
Description:
Cytosolic phospholipase A2Phospholipase A2Lysophospholipase [Source:UniProtKB/Swiss-Prot;Acc:P50392]
Human Orthologue:
PLA2G4A
Human Description:
phospholipase A2, group IVA (cytosolic, calcium-dependent) [Source:HGNC Symbol;Acc:9035]
Mouse Orthologue:
Pla2g4a
Mouse Description:
phospholipase A2, group IVA (cytosolic, calcium-dependent) Gene [Source:MGI Symbol;Acc:MGI:1195256]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7312 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031543 None None 560 None 11
ENSDART00000099913 Nonsense 50 741 4 18
Genomic Location:
Chromosome 2 (position 20722819)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACACCCCGGACCCTTATGTTGAGCTGTCAGTGCCAACCACACCAGAGT[C/A]AARAAAACGAMCCCGCCACATTAACAATGACATTAACCCCAAGTGGAACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Epilepsy (generalized): Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 (View Study)
  • Knee osteoarthritis: Genome-wide association scan identifies a prostaglandin-endoperoxide synthase 2 variant involved in risk of knee osteoarthritis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nggkne3b