emilin1a

Ensembl ID:
ENSDARG00000024537
ZFIN ID:
ZDB-GENE-041001-191
Description:
EMILIN-1 [Source:RefSeq peptide;Acc:NP_001025378]
Human Orthologue:
EMILIN1
Human Description:
elastin microfibril interfacer 1 [Source:HGNC Symbol;Acc:19880]
Mouse Orthologue:
Emilin1
Mouse Description:
elastin microfibril interfacer 1 Gene [Source:MGI Symbol;Acc:MGI:1926189]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1155 Nonsense Available for shipment Available now
sa37101 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa37102 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035612 Nonsense 375 1008 4 7
ENSDART00000128895 Nonsense 375 1014 4 8
Genomic Location (Zv9):
Chromosome 20 (position 34884722)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34957235
KASP Assay ID:
554-1066.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATAACCGCCTTCGAGACCTGGAGCGGAGATTGAATGGGACTGTGAGA[A/T]AAACTGAGCAAAAATGCTCCCATACAGAGACAAGTATGAAGGAGTTTGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa37101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035612 Splice Site, Nonsense 815 1008 4 7
ENSDART00000128895 Splice Site, Nonsense 815 1014 4 8
Genomic Location (Zv9):
Chromosome 20 (position 34886042)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34958555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGGAATGTTCTCAAGGAGTTCCAGATCTTCACTGAACAGGACTTTACT[G/T]GTACGTTCTTAGAATTTATACAGTATACAACATATAGAAATTTGCTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035612 Essential Splice Site 853 1008 5 7
ENSDART00000128895 Essential Splice Site 853 1014 5 8
Genomic Location (Zv9):
Chromosome 20 (position 34887636)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34960149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAGGAAAGGAAGGCCCACAAGGGAGAGTGGGGCCGGTAGGACCCCCAG[G/T]TAATTAAATGACAACAAATAAATAAATACTACAAAGTTGTAACAACACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link