emilin1a

Ensembl ID:
ENSDARG00000024537
ZFIN ID:
ZDB-GENE-041001-191
Description:
EMILIN-1 [Source:RefSeq peptide;Acc:NP_001025378]
Human Orthologue:
EMILIN1
Human Description:
elastin microfibril interfacer 1 [Source:HGNC Symbol;Acc:19880]
Mouse Orthologue:
Emilin1
Mouse Description:
elastin microfibril interfacer 1 Gene [Source:MGI Symbol;Acc:MGI:1926189]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3100 Nonsense Mutation detected in F1 DNA During 2014
sa1155 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035612 Nonsense 48 1008 1 7
ENSDART00000128895 Nonsense 48 1014 1 8
Genomic Location:
Chromosome 20 (position 34870746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAACATGTGGATGAGAATCAGTYTGGAGCAGCAGCACAGAGTGGATCT[A/T]AGGTGACCAGCAGACATAGGTAAGACAGCACCAGTGTCTTCATTTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035612 Nonsense 375 1008 4 7
ENSDART00000128895 Nonsense 375 1014 4 8
Genomic Location:
Chromosome 20 (position 34884722)
KASP Assay ID:
554-1066.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATAACCGCCTTCGAGACCTGGAGCGGAGATTGAATGGGACTGTGAGA[A/T]AAACTGAGCAAAAATGCTCCCATACAGAGACAAGTATGAAGGAGTTTGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6dg0xca3