bxdc2

Ensembl ID:
ENSDARG00000024511
ZFIN ID:
ZDB-GENE-060518-1
Description:
brix domain containing 2 [Source:RefSeq peptide;Acc:NP_001166027]
Human Orthologue:
BRIX1
Human Description:
BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24170]
Mouse Orthologue:
Brix1
Mouse Description:
BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915082]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3128 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa3128
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033069 Nonsense 235 383 8 10
ENSDART00000033069 Nonsense 235 383 8 10
Genomic Location (Zv9):
Chromosome 21 (position 248654)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 205669
KASP Assay ID:
554-3273.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWGCTCGTGTCCTGCAGGTCTTCTCCACCCCGCTGCACCACCCTAAGAGT[C/T]AGCCGTTCGTGGATCATGTCATYAGCTTCAGCATTGCAGACCACAGGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link