c6ast3

Ensembl ID:
ENSDARG00000024503
ZFIN ID:
ZDB-GENE-050320-99
Description:
six-cysteine containing astacin protease 3 [Source:RefSeq peptide;Acc:NP_001013544]
Human Orthologue:
ASTL
Human Description:
astacin-like metallo-endopeptidase (M12 family) [Source:HGNC Symbol;Acc:31704]
Mouse Orthologue:
Astl
Mouse Description:
astacin-like metalloendopeptidase (M12 family) Gene [Source:MGI Symbol;Acc:MGI:3046414]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40959 Nonsense Mutation detected in F1 DNA During 2017
sa38629 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030900 Nonsense 64 254 4 9
ENSDART00000114934 Nonsense 65 255 5 10
Genomic Location (Zv9):
Chromosome 7 (position 40035797)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38372437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGACGACATTGCTGTGAATGAGAAAAATGCTGATCCCTGCACCTCCTA[C/A]GGCTGTCTCTGGCCCAAATACAGTGATGGCAAGATTTATGTGCCTTACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030900 Essential Splice Site 86 254 4 9
ENSDART00000114934 Essential Splice Site 87 255 5 10
Genomic Location (Zv9):
Chromosome 7 (position 40035729)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38372369
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGTGATGGCAAGATTTATGTGCCTTACGTCATCGCCAACCACTACT[G/T]TAAGTCATTAATTACACAGAAAAAAAGTAGGCCAAATACAGAACTCTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link