col9a2

Ensembl ID:
ENSDARG00000024492
ZFIN ID:
ZDB-GENE-030131-9786
Description:
collagen alpha-2(IX) chain precursor [Source:RefSeq peptide;Acc:NP_997744]
Human Orthologue:
COL9A2
Human Description:
collagen, type IX, alpha 2 [Source:HGNC Symbol;Acc:2218]
Mouse Orthologue:
Col9a2
Mouse Description:
collagen, type IX, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88466]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9812 Nonsense Available for shipment Available now
sa8661 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033037 Nonsense 155 690 9 35
ENSDART00000035093 Nonsense 155 691 9 32

The following transcripts of ENSDARG00000024492 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 39983922)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGTGTCATGGGAAGTCCMGGACCTTCAGGATTACCAGGACCTCCAGGC[A/T]AGCCTGTAAGTCACAGTAATGTTTCATTTACTTCACTATGAAATATCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033037 Essential Splice Site 281 690 19 35
ENSDART00000035093 Essential Splice Site 282 691 16 32

The following transcripts of ENSDARG00000024492 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 39996356)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAGGACCCCAAGGACCACCTGGAGAGCCTGGTGACAAAGGAGACATG[G/A]TATGAATCACTAATATTATATACAACTTTTCATCCAGTCATTAWWTTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lypap4y3