top2a

Ensembl ID:
ENSDARG00000024488
ZFIN ID:
ZDB-GENE-030131-2453
Description:
DNA topoisomerase 2-alpha [Source:RefSeq peptide;Acc:NP_001003834]
Human Orthologues:
TOP2A, TOP2B
Human Descriptions:
topoisomerase (DNA) II alpha 170kDa [Source:HGNC Symbol;Acc:11989]
topoisomerase (DNA) II beta 180kDa [Source:HGNC Symbol;Acc:11990]
Mouse Orthologues:
Top2a, Top2b
Mouse Descriptions:
topoisomerase (DNA) II alpha Gene [Source:MGI Symbol;Acc:MGI:98790]
topoisomerase (DNA) II beta Gene [Source:MGI Symbol;Acc:MGI:98791]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2661 Nonsense F2 line generated During 2014
sa7689 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2661
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106152 Nonsense 330 811 6 16
ENSDART00000106153 Nonsense 334 815 7 17
Genomic Location:
Chromosome 12 (position 11708617)
KASP Assay ID:
554-3448.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCCGCATGCTTCAGCAGATGGGCTAYGACTCRGACCCTGTTAAAGCAT[G/A]GAAAGATGCTCAGGAGAAGGTACRYGACTGCAGTCAAATTAAATGCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106152 Essential Splice Site 475 811 9 16
ENSDART00000106153 Essential Splice Site 479 815 10 17
Genomic Location:
Chromosome 12 (position 11710532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCATGAAGGTCCAGGCTGTAAAAAAAGAGCGAGGCAAAGGATCGAAGG[T/C]ATGTGTGTGGAATGAGATGACGTGTGTGGCACCTTAAGTGKTCCTYTAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pf5kms9j