pigk

Ensembl ID:
ENSDARG00000024479
ZFIN ID:
ZDB-GENE-040625-162
Description:
GPI-anchor transamidase [Source:RefSeq peptide;Acc:NP_001002149]
Human Orthologue:
PIGK
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class K [Source:HGNC Symbol;Acc:8965]
Mouse Orthologue:
Pigk
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class K Gene [Source:MGI Symbol;Acc:MGI:1913863]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32845 Nonsense Mutation detected in F1 DNA During 2017
sa31257 Essential Splice Site Available for shipment Available now
sa5716 Essential Splice Site F2 line generated During 2017
sa2045 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa32845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028906 Nonsense 121 389 4 11
Genomic Location (Zv9):
Chromosome 2 (position 8851563)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9269217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGCTCAATGTGTATGGAGACGACGTGGAGGTGGATTACCGCGGATA[T/A]GAGGTGAAGCTGCTTTTGGTTTTAAATTAACAGTAGTAATACTGAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31257
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028906 Essential Splice Site 326 389 9 11
Genomic Location (Zv9):
Chromosome 2 (position 8875514)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9293168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAGGACACAATCAGTCTGACGTGTCCTGTAGAGTCGCCAATGCAGAG[G/A]TAAGTAGACCACAAACGTAACTGTGTAAATGATTATACCCATTATTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5716
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028906 Essential Splice Site 351 389 10 11
ENSDART00000028906 Essential Splice Site 351 389 10 11
Genomic Location (Zv9):
Chromosome 2 (position 8894954)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9312608
KASP Assay ID:
554-2895.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTTTACGTATGTGGACCAACTTCCAGTTGYTGAAATTATTCATCAGG[T/C]AAGTCYATAGTTAACTGTTATTGAAATGTTTAAAYTAAGGAATATAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2045
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028906 Essential Splice Site 351 389 10 11
ENSDART00000028906 Essential Splice Site 351 389 10 11
Genomic Location (Zv9):
Chromosome 2 (position 8894954)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9312608
KASP Assay ID:
554-2895.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTTTACGTATGTGGACCAACTTCCAGTTGYTGAAATTATTCATCAGG[T/C]AAGTCTATAGTTAACTGTTATTGAAATGTTTAAATTAAGGAATATAGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link