si:ch211-147d7.3

Ensembl ID:
ENSDARG00000024471
ZFIN ID:
ZDB-GENE-041014-362
Description:
kinetochore-associated protein NSL1 homolog [Source:RefSeq peptide;Acc:NP_001020692]
Human Orthologue:
NSL1
Human Description:
NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24548]
Mouse Orthologue:
Nsl1
Mouse Description:
NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:26

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa751 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032978 Essential Splice Site 83 238 2 6
Genomic Location (Zv9):
Chromosome 20 (position 37844778)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37917291
KASP Assay ID:
554-0658.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTATTGGTGGATTGTCATGGGATGAGACGTCAGAGGAATACTGTGAAGG[T/C]AAGTTACTCTCACTCTTACTAAAACCTTMATCTATTTTGTAAAACRATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link