mrps18a

Ensembl ID:
ENSDARG00000024465
ZFIN ID:
ZDB-GENE-041210-109
Description:
28S ribosomal protein S18a, mitochondrial [Source:RefSeq peptide;Acc:NP_001025285]
Human Orthologue:
MRPS18A
Human Description:
mitochondrial ribosomal protein S18A [Source:HGNC Symbol;Acc:14515]
Mouse Orthologue:
Mrps18a
Mouse Description:
mitochondrial ribosomal protein S18A Gene [Source:MGI Symbol;Acc:MGI:1915815]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31373 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028941 Nonsense 201 210 6 6
Genomic Location (Zv9):
Chromosome 4 (position 5518141)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5636322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAATAGAATGGTTGTTGGACATCCTGCCCTGAAAAACAATGTCAGATA[C/A]AACCCCAAACCCTGGTACTTAAAGCACTGATGGACAGATCTGTTTACTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link