gnpda2

Ensembl ID:
ENSDARG00000024443
ZFIN ID:
ZDB-GENE-091117-41
Human Orthologue:
GNPDA2
Human Description:
glucosamine-6-phosphate deaminase 2 [Source:HGNC Symbol;Acc:21526]
Mouse Orthologue:
Gnpda2
Mouse Description:
glucosamine-6-phosphate deaminase 2 Gene [Source:MGI Symbol;Acc:MGI:1915230]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24951 Nonsense Mutation detected in F1 DNA During 2014
sa13521 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038301 Nonsense 28 277 1 6
ENSDART00000136474 Nonsense 28 277 2 7

The following transcripts of ENSDARG00000024443 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 4517018)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCAGCGAATGGGCTGCAAAGTACATCCGCAACCGGATCATCCAGTTC[A/T]AACCCAGTGCTGACCGCTACTTCACTTTAGGACTTCCAACAGGTAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038301 Essential Splice Site 42 277 None 6
ENSDART00000136474 Essential Splice Site 42 277 None 7

The following transcripts of ENSDARG00000024443 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 4516974)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTCAAACCCAGTGCTGACCGCTACTTCACTTTAGGACTTCCAACAGG[T/G]AAATTGAACGTGTAAARTCAGCATTTTACCCTGCTTTGTTAGGAAAGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Body mass index: Six new loci associated with body mass index highlight a neuronal influence on body weight regulation. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/14ajderz