gnpda2

Ensembl ID:
ENSDARG00000024443
ZFIN ID:
ZDB-GENE-091117-41
Human Orthologue:
GNPDA2
Human Description:
glucosamine-6-phosphate deaminase 2 [Source:HGNC Symbol;Acc:21526]
Mouse Orthologue:
Gnpda2
Mouse Description:
glucosamine-6-phosphate deaminase 2 Gene [Source:MGI Symbol;Acc:MGI:1915230]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24951 Nonsense Mutation detected in F1 DNA During 2016
sa13521 Essential Splice Site Available for shipment Available now
sa42338 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038301 Nonsense 28 277 1 6
ENSDART00000136474 Nonsense 28 277 2 7

The following transcripts of ENSDARG00000024443 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 4517018)
KASP Assay ID:
554-7747.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCAGCGAATGGGCTGCAAAGTACATCCGCAACCGGATCATCCAGTTC[A/T]AACCCAGTGCTGACCGCTACTTCACTTTAGGACTTCCAACAGGTAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038301 Essential Splice Site 42 277 None 6
ENSDART00000136474 Essential Splice Site 42 277 None 7

The following transcripts of ENSDARG00000024443 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 4516974)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTCAAACCCAGTGCTGACCGCTACTTCACTTTAGGACTTCCAACAGG[T/G]AAATTGAACGTGTAAARTCAGCATTTTACCCTGCTTTGTTAGGAAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038301 Nonsense 95 277 3 6
ENSDART00000136474 Nonsense 95 277 4 7

The following transcripts of ENSDARG00000024443 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 4514787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGAGATCATCCAGAGAGCTATCACTCCTACATGTGGAATAACTTCTTC[A/T]AGCACATCGACATTGAACCCCAAAACACTCATATACTGGACGGCAACGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Body mass index: Six new loci associated with body mass index highlight a neuronal influence on body weight regulation. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link