ENSDARG00000024431

Ensembl ID:
ENSDARG00000024431

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32223 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43179 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032184 Essential Splice Site 37 219 5 7
ENSDART00000128738   None 239 None 6
Genomic Location (Zv9):
Chromosome 18 (position 46859674)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48301455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTATGGCTTTACATTTACTTAAGTGATACTTACTTAACATTGTGTGT[G/A]TTGTCTCTGCAGACCCGCGTGAGTGGACAGAAGGCCATGTGAGGGAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032184 Nonsense 150 219 7 7
ENSDART00000128738 Nonsense 170 239 6 6
Genomic Location (Zv9):
Chromosome 18 (position 46855455)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48297236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGACTATGGCATTGAGCATCCTCAGTGTGTCCCTCCGTCTGAATACTCT[G/T]AGCCGAGCTTCATCACAGAGTCCTATCAGACGCTTCACCCCATCAGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link