GET4

Ensembl ID:
ENSDARG00000024398
Description:
golgi to ER traffic protein 4 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:21690]
Human Orthologue:
GET4
Human Description:
golgi to ER traffic protein 4 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:21690]
Mouse Orthologue:
Get4
Mouse Description:
golgi to ER traffic protein 4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914854]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17909 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036989 Nonsense 253 328 7 9
Genomic Location:
Chromosome 12 (position 12401044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAATCAACCTAATTTCCAGATGATTGTGGCTTTCTTTTCAGAGGGAAGT[T/A]GACAGTCTTCACAGTGTTAWGCGAGCAGTATCAACCATCACTGAAGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2ivpjnnh