msto1

Ensembl ID:
ENSDARG00000024381
ZFIN ID:
ZDB-GENE-030131-6238
Description:
Protein misato homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1L908]
Human Orthologue:
MSTO1
Human Description:
misato homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:29678]
Mouse Orthologue:
Msto1
Mouse Description:
misato homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2385175]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17624 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037515 Essential Splice Site 233 591 7 14
Genomic Location:
Chromosome 19 (position 761625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGAGGACCGGCTGCATTTCTTCAYTGAGGAGTGTGACTATCTGCAGG[T/C]AACACACAGCACCTATTTTGGTGAAYGCAAAAGKTTTTGAAAGAATAKAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/67wp6vph