cdh1

Ensembl ID:
ENSDARG00000024371
ZFIN ID:
ZDB-GENE-010606-1
Description:
cadherin 1, epithelial [Source:RefSeq peptide;Acc:NP_571895]
Human Orthologues:
CDH1, CDH3
Human Descriptions:
cadherin 1, type 1, E-cadherin (epithelial) [Source:HGNC Symbol;Acc:1748]
cadherin 3, type 1, P-cadherin (placental) [Source:HGNC Symbol;Acc:1762]
Mouse Orthologues:
Cdh1, Cdh3
Mouse Descriptions:
cadherin 1 Gene [Source:MGI Symbol;Acc:MGI:88354]
cadherin 3 Gene [Source:MGI Symbol;Acc:MGI:88356]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2411 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa5445 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097719 Splice Site, Nonsense 323 864 8 16
ENSDART00000147057 None None 123 None 3
Genomic Location:
Chromosome 7 (position 56222333)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCAGTTGCTGAATTTATTCTAGCAAGTTCATTCATCTTCCTCTTTCAG[C/T]AATGGTTCAGATATACTTTGGTTATTACGGCCACTGACATGAACGGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097719 Nonsense 684 864 13 16
ENSDART00000147057 None None 123 None 3
Genomic Location:
Chromosome 7 (position 56224317)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCAAGTGTGTGTGACTGCAAAGGAGAGGCATTCCAATGTACTGATAAA[C/T]AAGTAGCAGGGATTCCACTGTTTGGAGTTCTTGGTGTCCTGGGAGGAATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Meta-analysis of genome-wide association data identifies four new susceptibility loci for colorectal cancer. (View Study)
  • Ulcerative colitis: Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yr8i1bwa