col4a3bp

Ensembl ID:
ENSDARG00000024325
ZFIN ID:
ZDB-GENE-080724-10
Description:
Collagen type IV alpha-3-binding protein [Source:UniProtKB/Swiss-Prot;Acc:Q5M7Y0]
Human Orthologue:
COL4A3BP
Human Description:
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein [Source:HGNC Symbol;Acc:2205]
Mouse Orthologue:
Col4a3bp
Mouse Description:
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26571 Nonsense Mutation detected in F1 DNA During 2016
sa18820 Nonsense Mutation detected in F1 DNA During 2016
sa9854 Nonsense Available for shipment Available now
sa40554 Nonsense Mutation detected in F1 DNA During 2016
sa33707 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035299 Nonsense 82 620 3 17
ENSDART00000092938 Nonsense 82 594 3 16
Genomic Location (Zv9):
Chromosome 5 (position 52614399)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50281595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATCTGTTATGTTTGCTTTCTCTTTTAGCCTCATGAGTTTGATGAATGC[C/T]GATTTGACATCAGTGTGAACGACAGCATCTGGTACCTGAGGGCTGAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035299 Nonsense 273 620 7 17
ENSDART00000092938 Nonsense 273 594 7 16
ENSDART00000035299 Nonsense 273 620 7 17
ENSDART00000092938 Nonsense 273 594 7 16
Genomic Location (Zv9):
Chromosome 5 (position 52635990)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50303186
KASP Assay ID:
2259-6489.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCCACTGCATCGACATTTTAGTCAAACGAGAGGAGAGCTGGCAGAAA[C/T]GACTCGATAAGGTAGTGTGCAGCAGACATTTAAAAGGATGTTTTGTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035299 Nonsense 273 620 7 17
ENSDART00000092938 Nonsense 273 594 7 16
ENSDART00000035299 Nonsense 273 620 7 17
ENSDART00000092938 Nonsense 273 594 7 16
Genomic Location (Zv9):
Chromosome 5 (position 52635990)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50303186
KASP Assay ID:
2259-6489.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCCACTGCATCGAYATTTTAGTCAAACGAGAGGAGAGCTGGCAGAAA[C/T]GACTCGATAAGGYAGTGTGCAGCAGACATTTAAAAGGATGTTTTGTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035299 Nonsense 403 620 12 17
ENSDART00000092938 Nonsense 377 594 11 16
Genomic Location (Zv9):
Chromosome 5 (position 52644953)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50312149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTGGTTTTGTTCACAGGTTGAGGAGATGGTGCACAGTCACATGACGTA[T/A]TCTTTACAGGATGTTGGTGGAGATGCTAACTGGCAACTGGTTGTTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035299 Nonsense 522 620 15 17
ENSDART00000092938 Nonsense 496 594 14 16
Genomic Location (Zv9):
Chromosome 5 (position 52649215)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50316411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTTATGCGTAAAATTCTGTCCACCAATGAGAACGATCCAGACACCTG[G/A]CTGGTCTGCAACTTCTCAGTGGATCATGATGGTTATCCAGTGAGTTCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link