col4a3bp

Ensembl ID:
ENSDARG00000024325
ZFIN ID:
ZDB-GENE-080724-10
Description:
Collagen type IV alpha-3-binding protein [Source:UniProtKB/Swiss-Prot;Acc:Q5M7Y0]
Human Orthologue:
COL4A3BP
Human Description:
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein [Source:HGNC Symbol;Acc:2205]
Mouse Orthologue:
Col4a3bp
Mouse Description:
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18820 Nonsense Mutation detected in F1 DNA During 2014
sa9854 Nonsense Available for shipment Available now
sa18821 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3557 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035299 Nonsense 273 620 7 17
ENSDART00000092938 Nonsense 273 594 7 16
ENSDART00000035299 Nonsense 273 620 7 17
ENSDART00000092938 Nonsense 273 594 7 16
Genomic Location:
Chromosome 5 (position 52635990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCCACTGCATCGACATTTTAGTCAAACGAGAGGAGAGCTGGCAGAAA[C/T]GACTCGATAAGGTAGTGTGCAGCAGACATTTAAAAGGATGTTTTGTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035299 Nonsense 273 620 7 17
ENSDART00000092938 Nonsense 273 594 7 16
ENSDART00000035299 Nonsense 273 620 7 17
ENSDART00000092938 Nonsense 273 594 7 16
Genomic Location:
Chromosome 5 (position 52635990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCCACTGCATCGAYATTTTAGTCAAACGAGAGGAGAGCTGGCAGAAA[C/T]GACTCGATAAGGYAGTGTGCAGCAGACATTTAAAAGGATGTTTTGTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035299 Essential Splice Site 276 620 7 17
ENSDART00000092938 Essential Splice Site 276 594 7 16
ENSDART00000035299 Essential Splice Site 276 620 7 17
ENSDART00000092938 Essential Splice Site 276 594 7 16
Genomic Location:
Chromosome 5 (position 52636003)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACATTTTAGTCAAACGAGAGGAGAGCTGGCAGAAACGACTCGATAAGG[T/C]AGTGTGCAGCAGACATTTAAAAGGATGTTTTGTCTAAAAATAAACTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035299 Essential Splice Site 276 620 7 17
ENSDART00000092938 Essential Splice Site 276 594 7 16
ENSDART00000035299 Essential Splice Site 276 620 7 17
ENSDART00000092938 Essential Splice Site 276 594 7 16
Genomic Location:
Chromosome 5 (position 52636003)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACATTTTAGTCAAACGAGAGGAGAGCTGGCAGAAACGACTCGATAAGG[T/C]AGTGTGCAGCAGACATTTAAAAGGATGTTTTGTCTAAAAATAAACTTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8ay8r57k