herpud1

Ensembl ID:
ENSDARG00000024314
ZFIN ID:
ZDB-GENE-050913-47
Description:
homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein [Sour
Human Orthologue:
HERPUD1
Human Description:
homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 [Sour
Mouse Orthologue:
Herpud1
Mouse Description:
homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 Gene

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25059 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034287 Nonsense 112 408 4 8

The following transcripts of ENSDARG00000024314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 17261972)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17613738
KASP Assay ID:
554-7643.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCCCTTTTTTTTCTCTCTAATCTTGCGTACAGGTGACATCGACACAC[C/T]AGCAGAGTTCACAGCCTTCCCCGCTAACTCCTAGCCAGTCTTCTGGACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiovascular disease risk factors: Longitudinal genome-wide association of cardiovascular disease risk factors in the Bogalusa heart study. (View Study)
  • HDL cholesterol: Polymorphism in the CETP gene region, HDL cholesterol, and risk of future myocardial infarction: Genomewide analysis among 18 245 initially healthy women from the Women's Genome Health Study. (View Study)
  • Metabolic syndrome: A genome-wide association study of the metabolic syndrome in Indian Asian men. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link