c1qtnf4

Ensembl ID:
ENSDARG00000024299
ZFIN ID:
ZDB-GENE-050417-198
Description:
complement C1q tumor necrosis factor-related protein 4 [Source:RefSeq peptide;Acc:NP_001017702]
Human Orthologue:
C1QTNF4
Human Description:
C1q and tumor necrosis factor related protein 4 [Source:HGNC Symbol;Acc:14346]
Mouse Orthologue:
C1qtnf4
Mouse Description:
C1q and tumor necrosis factor related protein 4 Gene [Source:MGI Symbol;Acc:MGI:1914695]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1474 Nonsense F2 line generated During 2016
sa40958 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1474
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035006 Nonsense 266 339 2 2
ENSDART00000137424 Nonsense 308 381 2 2
Genomic Location (Zv9):
Chromosome 7 (position 39994490)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38331130
KASP Assay ID:
554-1399.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCCATAAGACCCTGTCAGTGAAGCTGATGAAGAATCATTTGGAGGTA[C/T]AGACCATGATCTACGATGACAGTGACACTGAGAAGGCCCTGCAGAGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035006 Nonsense 335 339 2 2
ENSDART00000137424 Nonsense 377 381 2 2
Genomic Location (Zv9):
Chromosome 7 (position 39994283)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38330923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCCTGGTGTATCCTGAGCTGCACCTCAGCCTTCCTCAGCCGCAGAAA[C/T]AGGATAAGACACTGTAGGCCTGTCAGGGAGACAGTCTGTCTGTGGGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link