LOC570397

Ensembl ID:
ENSDARG00000024208
Human Orthologue:
OPN5
Human Description:
opsin 5 [Source:HGNC Symbol;Acc:19992]
Mouse Orthologue:
Opn5
Mouse Description:
opsin 5 Gene [Source:MGI Symbol;Acc:MGI:2662912]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18114 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18114
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033404 Nonsense 70 415 2 5
Genomic Location:
Chromosome 20 (position 6302840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTTTCCATTTGCAGGTGGCTGTATGGAASAACAGTGTGTGTGAYCTA[T/A]GCCTTCTGTGGTGTCTTATTTGGGATCTGCTCTCTSACCACTCTCACTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5q132yau