pnoc

Ensembl ID:
ENSDARG00000024189
ZFIN ID:
ZDB-GENE-040114-1
Description:
prepronociceptin [Source:RefSeq peptide;Acc:NP_001015044]
Human Orthologue:
PNOC
Human Description:
prepronociceptin [Source:HGNC Symbol;Acc:9163]
Mouse Orthologue:
Pnoc
Mouse Description:
prepronociceptin Gene [Source:MGI Symbol;Acc:MGI:105308]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14456 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034252 Nonsense 66 233 3 3
Genomic Location (Zv9):
Chromosome 20 (position 34757818)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34830331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGCGTCTCCGGCACTGACCTGGGATCTGTGTTACCAAGCAGCGGGTT[T/A]GAAGCATCTCCCACTGCCCTTGCAGGACGAGGAAACATCAAAGCGCTCRG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link