narf

Ensembl ID:
ENSDARG00000024184
ZFIN ID:
ZDB-GENE-040718-31
Description:
Nuclear prelamin A recognition factor [Source:UniProtKB/Swiss-Prot;Acc:Q6DHP6]
Human Orthologue:
NARF
Human Description:
nuclear prelamin A recognition factor [Source:HGNC Symbol;Acc:29916]
Mouse Orthologue:
Narf
Mouse Description:
nuclear prelamin A recognition factor Gene [Source:MGI Symbol;Acc:MGI:1914858]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35338 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa27988 Nonsense Mutation detected in F1 DNA During 2018
sa22143 Nonsense Available for shipment Available now
sa6266 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007053 Splice Site, Nonsense 20 465 3 12
ENSDART00000142716 Splice Site, Nonsense 20 131 3 5

The following transcripts of ENSDARG00000024184 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 34960155)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33364264
GRCz11 12 33465247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTGCTTAAACACTCATTGTGGTTTATTTTCTGTTCCACTTTATAGTG[C/A]AACAAGAAACAAAGTGATGAAAGTATAAACTCACTTCAAGAGAAAGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007053 Nonsense 74 465 4 12
ENSDART00000142716 Nonsense 74 131 4 5

The following transcripts of ENSDARG00000024184 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 34960497)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33364606
GRCz11 12 33465589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCTGTGACGGCTGTATATCGGAGGATGAAGGCAAGAGAATATCACAG[C/T]AGAATCTGGACGAGATCAATCACGTGCTTGCTCTCAACAAGGTAGCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007053 Nonsense 122 465 5 12
ENSDART00000142716 Nonsense 122 131 5 5

The following transcripts of ENSDARG00000024184 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 34960716)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33364825
GRCz11 12 33465808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTGCCATTTTTTGCTGTTAAATTTCAGTTGGACGTTTCAGCAGCTGCA[C/T]AGAAACTTTGTGGCTTCCTCAAGAGTGTGGGTACGTCTGGACGCCATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007053 Essential Splice Site 176 465 6 12
ENSDART00000142716   None 131 None 5

The following transcripts of ENSDARG00000024184 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 34962478)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33366587
GRCz11 12 33467570
KASP Assay ID:
554-5169.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAACATCATGACGCTAATGCTATGCCTATGTTCACATCCTCCTGTCCAG[G/A]TAAGACAATYCTGATTCAAGTATATGCTCTTTTACRTCTCTTAAAGTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link