kcnh1

Ensembl ID:
ENSDARG00000024167
ZFIN ID:
ZDB-GENE-061226-1
Description:
potassium voltage-gated channel subfamily H member 1 [Source:RefSeq peptide;Acc:NP_001038396]
Human Orthologue:
KCNH1
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 1 [Source:HGNC Symbol;Acc:6250]
Mouse Orthologue:
Kcnh1
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 1 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11625 Nonsense Available for shipment Available now
sa23088 Nonsense Mutation detected in F1 DNA During 2014
sa23089 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9197 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029703 Nonsense 88 959 3 11
Genomic Location:
Chromosome 17 (position 25526954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACAGACAAGGACACAAGTGAAAAAGTTCGACTAACCTTCGAAAACTA[T/A]GAGATGAACTCGTTTGAGATCTTGATGTACAAGAAAAACAGTGAGGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029703 Nonsense 198 959 6 11
Genomic Location:
Chromosome 17 (position 25531104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACACGCAGGTTCTCCAGCTGGGCTCTGATATTCTGCCCCAGTACAAA[C/T]AAGAGACACCCAAAACCCCTCCTCACATCATCCTGCACTACTGTGCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029703 Essential Splice Site 675 959 10 11
Genomic Location:
Chromosome 17 (position 25587529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACCACTTCTCCAGAAACCTCCTGCTTACGTACAACCTGCGCAAACGG[G/T]TGAGTGAAAAGCTGTCTACTATTCTCATTCACTTTCTGCTGATTTGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029703 Nonsense 905 959 11 11
Genomic Location:
Chromosome 17 (position 25607362)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCCGAACACACGCTGCAAGCCTCGCTCTTGGAGCTCCGCACTGAACTC[A/T]AAGAAGAACTRTCGGCGCTCGGGAACCGAATGGTTGCGCTGGAGGCGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a4wvpb0p