hao1

Ensembl ID:
ENSDARG00000024160
ZFIN ID:
ZDB-GENE-060519-2
Description:
hydroxyacid oxidase 1 [Source:RefSeq peptide;Acc:NP_001077011]
Human Orthologue:
HAO1
Human Description:
hydroxyacid oxidase (glycolate oxidase) 1 [Source:HGNC Symbol;Acc:4809]
Mouse Orthologue:
Hao1
Mouse Description:
hydroxyacid oxidase 1, liver Gene [Source:MGI Symbol;Acc:MGI:96011]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28779 Nonsense Mutation detected in F1 DNA During 2017
sa42849 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030352 Nonsense 194 372 5 9
Genomic Location (Zv9):
Chromosome 17 (position 3841176)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 3895556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTTTTTTTCTACTTCTTCAGGATGGCGAATTTCGAGTCTCCAGATT[T/A]AGCGTTCTCCAAGAAAGAGGGTTACGGGGAGGACAGCGGGCTGGCGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030352 Essential Splice Site 244 372 6 9
Genomic Location (Zv9):
Chromosome 17 (position 3833234)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 3903498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTTCTCTTGTAGAATGATGAACACATTAATGGTGAATCTTGCATTTC[A/G]GCTGAAGACGCTAAAGAAGCATTGAAGTACGGCGTGGATGGAATACTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Genome-wide association analyses in East Asians identify new susceptibility loci for colorectal cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link